Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLPTM1 cdna clone

CLPTM1 cDNA Clone

Synonyms
CLPTM1; CLPTM1 cDNA Clone; CLPTM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcgcaggaggcggacggggcccgcagcgccgtggtggcggccgggggaggcagctccggtcaggtgaccagcaatggcagcatcgggagggacccgccagcggagacccagcctcagaacccaccggcccagccggcacccaatgcctggcaggtcatcaaaggtgtgctgtttaggatcttcatcatctgggccatcagcagttggttccgccgagggccggcccctcaggaccaggcgggccccggaggagccccacgcgtcgccagccgcaacctgttccccaaagacactttaatgaacctgcatgtgtacatctcagagcacgagcactttacagacttcaacgccacgtcggcactcttctgggaacagcacgatcttgtgtatggcgactggactagcggcgagaactcagacggctgctacgagcactttgctgagctcgatatcccacagagcgtccagcagaacggctccatctacatccacgtttacttcaccaagagtggcttccacccagacccccggcagaaggccctgtaccgccggcttgccacagtccacatgtcccggatgatcaacaaatacaagcgcagacgatttcagaaaaccaagaacctgctgacaggagagacagaagcggacccagaaatgatcaagagggctgaggactatgggcctgtggaggtgatctcccattggcaccccaacatcaccatcaacatcgtggacgaccacacgccgtgggtgaagggcagtgtgccccctcccctggatcaatatgtgaagttcgacgccgtgagcggtgactactatcccatcatctacttcaatgactactggaacctgcagaaggactactaccccatcaacgagagcctggccagcctgccgctccgcgtctccttctgcccgctctcgctttggcgctggcagctctatgctgcccagagcaccaagtcgccctggaacttcctgggtgatgagttgtacgagcagtcagatgaggagcaggactcggtgaaggtggccctgctggagaccaacccctacctgctggcgctcaccatcatcgtgtctatcgttcacagtgtcttcgagttcctggccttcaagaatgatatccagttctggaacagccggcagtccctggagggcctgtccgtgcgctccgtcttcttcggcgttttccagtcattcgtggtcctcctctacatcctggacaacgagaccaacttcgtggtccaggtcagcgtcttcattggggtcctcatcgacctctggaagatcaccaaggtcatggacgtccggctggaccgagagcacagggtggcaggaatcttcccccgcctatccttcaaggacaagtccacgtatatcgagtcctcgaccaaagtgtatgatgatatggcattccggtacctgtcctggatcctcttcccgctcctgggctgctatgccgtctacagtcttctgtacctggagcacaagggctggtactcctgggtgctcagcatgctctacggcttcctgctgaccttcggcttcatcaccatgacgccccagctcttcatcaactacaagctcaagtctgtggcccaccttccctggcgcatgctcacctacaaggccctcaacacattcatcgacgacctgttcgcctttgtcatcaagatgcccgttatgtaccggatcggctgcctgcgggacgatgtggttttcttcatctacctctaccaacggtggatctaccgcgtcgaccccacccgagtcaacgagtttggcatgagtggagaagaccccacagctgccgcccccgtggccgaggttcccacagcagcaggggccctcacgcccacacctgcacccaccacgaccaccgccaccagggaggaggcctccacgtccctgcccaccaagcccacccagggggccagctctgccagcgagccccagggtttgtttgtggaggcgctgtctgtccctctgtccctctgtgtttccagccatctcgccctgccagcccagcaccactgggaatcatggtga
Sequence Length
2061
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
75,178 Da
NCBI Official Full Name
Homo sapiens cleft lip and palate associated transmembrane protein 1, mRNA
NCBI Official Synonym Full Names
CLPTM1, transmembrane protein
NCBI Official Symbol
CLPTM1
NCBI Protein Information
cleft lip and palate transmembrane protein 1
UniProt Protein Name
Cleft lip and palate transmembrane protein 1
UniProt Gene Name
CLPTM1
UniProt Entry Name
CLPT1_HUMAN

Uniprot Description

CLPTM1: May play a role in T-cell development. Belongs to the CLPTM1 family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: external side of plasma membrane; integral to plasma membrane; membrane

Molecular Function: protein binding

Biological Process: regulation of T cell differentiation in the thymus

Research Articles on CLPTM1

Similar Products

Product Notes

The CLPTM1 clptm1 (Catalog #AAA1272111) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cgcaggaggc ggacggggcc cgcagcgccg tggtggcggc cgggggaggc agctccggtc aggtgaccag caatggcagc atcgggaggg acccgccagc ggagacccag cctcagaacc caccggccca gccggcaccc aatgcctggc aggtcatcaa aggtgtgctg tttaggatct tcatcatctg ggccatcagc agttggttcc gccgagggcc ggcccctcag gaccaggcgg gccccggagg agccccacgc gtcgccagcc gcaacctgtt ccccaaagac actttaatga acctgcatgt gtacatctca gagcacgagc actttacaga cttcaacgcc acgtcggcac tcttctggga acagcacgat cttgtgtatg gcgactggac tagcggcgag aactcagacg gctgctacga gcactttgct gagctcgata tcccacagag cgtccagcag aacggctcca tctacatcca cgtttacttc accaagagtg gcttccaccc agacccccgg cagaaggccc tgtaccgccg gcttgccaca gtccacatgt cccggatgat caacaaatac aagcgcagac gatttcagaa aaccaagaac ctgctgacag gagagacaga agcggaccca gaaatgatca agagggctga ggactatggg cctgtggagg tgatctccca ttggcacccc aacatcacca tcaacatcgt ggacgaccac acgccgtggg tgaagggcag tgtgccccct cccctggatc aatatgtgaa gttcgacgcc gtgagcggtg actactatcc catcatctac ttcaatgact actggaacct gcagaaggac tactacccca tcaacgagag cctggccagc ctgccgctcc gcgtctcctt ctgcccgctc tcgctttggc gctggcagct ctatgctgcc cagagcacca agtcgccctg gaacttcctg ggtgatgagt tgtacgagca gtcagatgag gagcaggact cggtgaaggt ggccctgctg gagaccaacc cctacctgct ggcgctcacc atcatcgtgt ctatcgttca cagtgtcttc gagttcctgg ccttcaagaa tgatatccag ttctggaaca gccggcagtc cctggagggc ctgtccgtgc gctccgtctt cttcggcgtt ttccagtcat tcgtggtcct cctctacatc ctggacaacg agaccaactt cgtggtccag gtcagcgtct tcattggggt cctcatcgac ctctggaaga tcaccaaggt catggacgtc cggctggacc gagagcacag ggtggcagga atcttccccc gcctatcctt caaggacaag tccacgtata tcgagtcctc gaccaaagtg tatgatgata tggcattccg gtacctgtcc tggatcctct tcccgctcct gggctgctat gccgtctaca gtcttctgta cctggagcac aagggctggt actcctgggt gctcagcatg ctctacggct tcctgctgac cttcggcttc atcaccatga cgccccagct cttcatcaac tacaagctca agtctgtggc ccaccttccc tggcgcatgc tcacctacaa ggccctcaac acattcatcg acgacctgtt cgcctttgtc atcaagatgc ccgttatgta ccggatcggc tgcctgcggg acgatgtggt tttcttcatc tacctctacc aacggtggat ctaccgcgtc gaccccaccc gagtcaacga gtttggcatg agtggagaag accccacagc tgccgccccc gtggccgagg ttcccacagc agcaggggcc ctcacgccca cacctgcacc caccacgacc accgccacca gggaggaggc ctccacgtcc ctgcccacca agcccaccca gggggccagc tctgccagcg agccccaggg tttgtttgtg gaggcgctgt ctgtccctct gtccctctgt gtttccagcc atctcgccct gccagcccag caccactggg aatcatggtg a. It is sometimes possible for the material contained within the vial of "CLPTM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.