Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLPB cdna clone

CLPB cDNA Clone

Gene Names
CLPB; SKD3; HSP78; MGCA7; ANKCLB; MEGCANN
Synonyms
CLPB; CLPB cDNA Clone; CLPB cdna clone
Ordering
For Research Use Only!
Sequence
atgctggggtccctggtgttgaggagaaaagcactggcgccacggctactcctccggctgctcaggtccccaacgctccggggccatggaggtgcttccggccggaatgtgactactgggagtctcggggagccgcagtggctgagggtagccaccggggggcgccctggaacatcgccggccttgttctccggacgtggggcagccaccggggggcgccagggaggacgcttcgataccaaatgcctcgcggctgccacttggggacgccttcctggtcccgaagaaacactcccaggacaggacagctggaacggggtccccagcagggccggactgggcatgtgcgccctggccgcagcgctggtggttcattgctacagcaagagtccgtccaacaaggatgcagccctgttggaagctgcccgtgccaacaatatgcaagaagtcagcaggctgttgtcagaaggtgcagatgtcaatgcaaagcacagacttggctggacagcactcatggtggcagccatcaaccgaaacaacagtgtggtacaggtcctgcttgctgctggggctgatccaaaccttggagatgatttcagcagtgtttacaagactgccaaggaacagggaatccattctttggaagatgggggacaggacggtgcaagccggcacatcacaaaccagtggacaagtgccctggagttcaggagatggctaggactccccgctggcgtcctgatcacccgagaggatgacttcaacaacaggctgaacaaccgcgccagtttcaagggctgcacggccttgcactatgctgttcttgctgatgactaccgcactgtcaaggagctgcttgatggaggagccaaccccctgcagaggaatgaaatgggacacacacccttggattatgcccgagaaggggaagtgatgaagcttctgaggacttctgaagccaagtaccaagagaagcagcggaagcgtgaggctgaggagcggcgccgcttccccctggagcagcgactaaaggagcacatcattggccaggagagcgccatcgccacagtgggtgctgcgatccggaggaaggagaatggctggtacgatgaagaacaccctctggtcttcctcttcttgggatcatctggaataggaaaaacagagctggccaagcagacagccaaatatatgcacaaagatgctaaaaagggcttcatcaggctggacatgtccgagttccaggagcgacacgaggtggccaagtttattgggtctccaccaggctacgttggccatgaggagggtggccagctgaccaagaagttgaagcagtgccccaatgctgtggtgctctttgatgaagtagacaaggcccatccagatgtgctcaccatcatgctgcagctgtttgatgagggccggctgacagatggaaaagggaagaccattgattgcaaggacgccatcttcatcatgacctccaatgtggccagcgacgagatcgcacagcacgcgctgcagctgaggcaggaagctttggagatgagccgtaaccgtattgccgaaaacctgggggatgtccagataagtgacaagatcaccatctcaaagaacttcaaggagaatgtgattcgccctatcctgaaagctcacttccggagggatgagtttctgggacggatcaatgagatcgtctacttcctccccttctgccactcggagctcatccaactcgtcaacaaggaactaaacttctgggccaagagagccaagcaaaggcacaacatcacgctgctctgggaccgcgaggtggcagatgtgctggtcgacggctacaatgtgcactatggcgcccgctccatcaaacatgaggtagaacgccgtgtggtgaaccagctggcagcagcctatgagcaggacctgctgccagggggctgtactttgcgcatcacggtggaggactcagacaagcagctactcaaaagcccagaactgccctcaccccaggctgagaagcgcctccccaagctgcgtctggagatcatcgacaaggacagcaagactcgcagactggacatccgggcaccactgcaccctgagaaggtgtgcaacaccatctag
Sequence Length
2124
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,664 Da
NCBI Official Full Name
Homo sapiens ClpB caseinolytic peptidase B homolog (E. coli), mRNA
NCBI Official Synonym Full Names
ClpB homolog, mitochondrial AAA ATPase chaperonin
NCBI Official Symbol
CLPB
NCBI Official Synonym Symbols
SKD3; HSP78; MGCA7; ANKCLB; MEGCANN
NCBI Protein Information
caseinolytic peptidase B protein homolog
UniProt Protein Name
Caseinolytic peptidase B protein homolog
Protein Family
UniProt Gene Name
CLPB
UniProt Synonym Gene Names
HSP78; SKD3
UniProt Entry Name
CLPB_HUMAN

NCBI Description

This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Uniprot Description

CLPB: May function as a regulatory ATPase and be related to secretion/protein trafficking process. Belongs to the clpA/clpB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial

Chromosomal Location of Human Ortholog: 11q13.4

Molecular Function: protein binding

Disease: 3-methylglutaconic Aciduria With Cataracts, Neurologic Involvement, And Neutropenia

Research Articles on CLPB

Similar Products

Product Notes

The CLPB clpb (Catalog #AAA1273073) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggggt ccctggtgtt gaggagaaaa gcactggcgc cacggctact cctccggctg ctcaggtccc caacgctccg gggccatgga ggtgcttccg gccggaatgt gactactggg agtctcgggg agccgcagtg gctgagggta gccaccgggg ggcgccctgg aacatcgccg gccttgttct ccggacgtgg ggcagccacc ggggggcgcc agggaggacg cttcgatacc aaatgcctcg cggctgccac ttggggacgc cttcctggtc ccgaagaaac actcccagga caggacagct ggaacggggt ccccagcagg gccggactgg gcatgtgcgc cctggccgca gcgctggtgg ttcattgcta cagcaagagt ccgtccaaca aggatgcagc cctgttggaa gctgcccgtg ccaacaatat gcaagaagtc agcaggctgt tgtcagaagg tgcagatgtc aatgcaaagc acagacttgg ctggacagca ctcatggtgg cagccatcaa ccgaaacaac agtgtggtac aggtcctgct tgctgctggg gctgatccaa accttggaga tgatttcagc agtgtttaca agactgccaa ggaacaggga atccattctt tggaagatgg gggacaggac ggtgcaagcc ggcacatcac aaaccagtgg acaagtgccc tggagttcag gagatggcta ggactccccg ctggcgtcct gatcacccga gaggatgact tcaacaacag gctgaacaac cgcgccagtt tcaagggctg cacggccttg cactatgctg ttcttgctga tgactaccgc actgtcaagg agctgcttga tggaggagcc aaccccctgc agaggaatga aatgggacac acacccttgg attatgcccg agaaggggaa gtgatgaagc ttctgaggac ttctgaagcc aagtaccaag agaagcagcg gaagcgtgag gctgaggagc ggcgccgctt ccccctggag cagcgactaa aggagcacat cattggccag gagagcgcca tcgccacagt gggtgctgcg atccggagga aggagaatgg ctggtacgat gaagaacacc ctctggtctt cctcttcttg ggatcatctg gaataggaaa aacagagctg gccaagcaga cagccaaata tatgcacaaa gatgctaaaa agggcttcat caggctggac atgtccgagt tccaggagcg acacgaggtg gccaagttta ttgggtctcc accaggctac gttggccatg aggagggtgg ccagctgacc aagaagttga agcagtgccc caatgctgtg gtgctctttg atgaagtaga caaggcccat ccagatgtgc tcaccatcat gctgcagctg tttgatgagg gccggctgac agatggaaaa gggaagacca ttgattgcaa ggacgccatc ttcatcatga cctccaatgt ggccagcgac gagatcgcac agcacgcgct gcagctgagg caggaagctt tggagatgag ccgtaaccgt attgccgaaa acctggggga tgtccagata agtgacaaga tcaccatctc aaagaacttc aaggagaatg tgattcgccc tatcctgaaa gctcacttcc ggagggatga gtttctggga cggatcaatg agatcgtcta cttcctcccc ttctgccact cggagctcat ccaactcgtc aacaaggaac taaacttctg ggccaagaga gccaagcaaa ggcacaacat cacgctgctc tgggaccgcg aggtggcaga tgtgctggtc gacggctaca atgtgcacta tggcgcccgc tccatcaaac atgaggtaga acgccgtgtg gtgaaccagc tggcagcagc ctatgagcag gacctgctgc cagggggctg tactttgcgc atcacggtgg aggactcaga caagcagcta ctcaaaagcc cagaactgcc ctcaccccag gctgagaagc gcctccccaa gctgcgtctg gagatcatcg acaaggacag caagactcgc agactggaca tccgggcacc actgcaccct gagaaggtgt gcaacaccat ctag. It is sometimes possible for the material contained within the vial of "CLPB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.