Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLN8 cdna clone

CLN8 cDNA Clone

Gene Names
CLN8; EPMR; C8orf61
Synonyms
CLN8; CLN8 cDNA Clone; CLN8 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccagagagaaggtcttctgggacctggcggccacgcgtgcagtctttggtgttcagagcacagccgcaggcctgtgggctctgctgggggaccctgtgctgcatgccgacaaggcgcgtggccagcagaactggtgctggtttcacatcacgacagcaacgggattcttttgctttgaaaatgttgcagtccacctgtccaacttgatcttccggacatttgacttgtttctggttatccaccatctctttgcctttcttgggtttcttggctgcttggtcaatctccaagctggccactatctagctatgaccacgttgctcctggagatgagcacgccctttacctgcgtttcctggatgctcttaaaggcgggctggtccgagtctctgttttggaagctcaaccagtggctgatgattcacatgtttcactgccgcatggttctaacctaccacatgtggtgggtgtgtttctggcactgggacggcctggtcagcagcctgtatctgcctcatttgacactgttccttgtcggactggctctgcttacgctaatcattaatccatattggacccataagaagactcagcagcttctcaatccggtggactggaacttcgcacagccagaagccaagagcaggccagaaggcaacgggcagctgctgcggaagaagaggccatag
Sequence Length
861
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,787 Da
NCBI Official Full Name
Homo sapiens ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation), mRNA
NCBI Official Synonym Full Names
ceroid-lipofuscinosis, neuronal 8
NCBI Official Symbol
CLN8
NCBI Official Synonym Symbols
EPMR; C8orf61
NCBI Protein Information
protein CLN8
UniProt Protein Name
Protein CLN8
Protein Family
UniProt Gene Name
CLN8
UniProt Synonym Gene Names
C8orf61
UniProt Entry Name
CLN8_HUMAN

NCBI Description

This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with progressive epilepsy with mental retardation (EMPR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2008]

Uniprot Description

CLN8: Could play a role in cell proliferation during neuronal differentiation and in protection against cell death. Defects in CLN8 are the cause of neuronal ceroid lipofuscinosis type 8 (CLN8). A form of neuronal ceroid lipofuscinosis with onset in childhood. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy. The lipopigment patterns observed most often in neuronal ceroid lipofuscinosis type 8 comprise mixed combinations of granular, curvilinear, and fingerprint profiles. Defects in CLN8 are the cause of neuronal ceroid lipofuscinosis type 8 Northern epilepsy variant (CLN8NE). A form of neuronal ceroid lipofuscinosis clinically characterized by epilepsy that presents between 5 and 10 years of age with frequent tonic-clonic seizures followed by progressive mental retardation. Visual loss is not a prominent feature. Intracellular accumulation of autofluorescent material results in curvilinear and granular profiles on ultrastructural analysis.

Protein type: Apoptosis; Endoplasmic reticulum; Membrane protein, integral; Cell development/differentiation; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 8p23

Cellular Component: endoplasmic reticulum; ER-Golgi intermediate compartment

Biological Process: ceramide metabolic process; cholesterol metabolic process; nervous system development; phospholipid metabolic process

Disease: Ceroid Lipofuscinosis, Neuronal, 8; Ceroid Lipofuscinosis, Neuronal, 8, Northern Epilepsy Variant

Research Articles on CLN8

Similar Products

Product Notes

The CLN8 cln8 (Catalog #AAA1269575) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcctg cgagcgatgg gggcacatca gagagcattt ttgacctgga ctatgcatcc tgggggatcc gctccacgct gatggtcgct ggctttgtct tctacttggg cgtctttgtg gtctgccacc agctgtcctc ttccctgaat gccacttacc gttctttggt ggccagagag aaggtcttct gggacctggc ggccacgcgt gcagtctttg gtgttcagag cacagccgca ggcctgtggg ctctgctggg ggaccctgtg ctgcatgccg acaaggcgcg tggccagcag aactggtgct ggtttcacat cacgacagca acgggattct tttgctttga aaatgttgca gtccacctgt ccaacttgat cttccggaca tttgacttgt ttctggttat ccaccatctc tttgcctttc ttgggtttct tggctgcttg gtcaatctcc aagctggcca ctatctagct atgaccacgt tgctcctgga gatgagcacg ccctttacct gcgtttcctg gatgctctta aaggcgggct ggtccgagtc tctgttttgg aagctcaacc agtggctgat gattcacatg tttcactgcc gcatggttct aacctaccac atgtggtggg tgtgtttctg gcactgggac ggcctggtca gcagcctgta tctgcctcat ttgacactgt tccttgtcgg actggctctg cttacgctaa tcattaatcc atattggacc cataagaaga ctcagcagct tctcaatccg gtggactgga acttcgcaca gccagaagcc aagagcaggc cagaaggcaa cgggcagctg ctgcggaaga agaggccata g. It is sometimes possible for the material contained within the vial of "CLN8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.