Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLIP1 cdna clone

CLIP1 cDNA Clone

Gene Names
CLIP1; RSN; CLIP; CYLN1; CLIP170; CLIP-170
Synonyms
CLIP1; CLIP1 cDNA Clone; CLIP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtatgctaaagccaagtgggcttaaggcccccaccaagatcctgaagcctggaagcacagctctgaagacacctacggctgttgtagctccagtagaaaaaaccatatccagtgaaaaagcatcaagcactccatcatctgagactcaggaggaatttgtggatgactttcgagttggggagcgagtttgggtgaatggaaataagcctggatttatccagtttcttggagaaacccagtttgcaccaggccagtgggctggaattgttttagatgaacccataggcaagaacgatggttcggtggcaggagttcggtatttccagtgtgaacctttaaagggcatatttacccgaccttcaaagttaacaaggaaggtgcaagcagaagatgaagctaatggcctgcagacaacgcccgcctcccgagctacttcaccgctgtgcacttctacggccagcatggtgtcttcctccccctccaccccttcaaacatccctcagaaaccatcacagccagcagcaaaggaaccttcagctacgcctccgatcagcaaccttacaaaaactgccagtgaatctatctccaacctttcagaggctggctcaatcaagaaaggagaaagagagctcaaaatcggagacagagtattggttggtggcactaaggctggtgtagtccggtttcttggggagaccgactttgccaagggggagtggtgtggcgtggagttagatgagccacttgggaagaatgatggcgctgttgctggaacaaggtattttcagtgtcaacccaaatatggcttgttcgctcctgtccacaaagttaccaagattggcttcccttccactacaccagccaaagccaaggccaacgcagtgaggcgagtgatggcgaccacgtccgccagcctgaagcgcagcccttctgcctcttccctcagctccatgagctcagtggcctcctctgtgagcagcaggcccagtcggacaggactagtaaggcccctttctcactacctgcctccacttcccaggcaggattaa
Sequence Length
1053
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
156,781 Da
NCBI Official Full Name
Homo sapiens CAP-GLY domain containing linker protein 1, mRNA
NCBI Official Synonym Full Names
CAP-Gly domain containing linker protein 1
NCBI Official Symbol
CLIP1
NCBI Official Synonym Symbols
RSN; CLIP; CYLN1; CLIP170; CLIP-170
NCBI Protein Information
CAP-Gly domain-containing linker protein 1
UniProt Protein Name
CAP-Gly domain-containing linker protein 1
UniProt Gene Name
CLIP1
UniProt Synonym Gene Names
CYLN1; RSN; CLIP-170
UniProt Entry Name
CLIP1_HUMAN

NCBI Description

The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

Restin: Binds to the plus end of microtubules and regulates the dynamics of the microtubule cytoskeleton. Promotes microtubule growth and microtubule bundling. Links cytoplasmic vesicles to microtubules and thereby plays an important role in intracellular vesicle trafficking. Plays a role macropinocytosis and endosome trafficking. Interacts with MTOR; phosphorylates and regulates CLIP1. Interacts (via CAP-Gly domains) with tubulin. Interacts with SLAIN2. Interacts (via zinc finger) with DCTN1. Interacts with MAPRE1 and MAPRE3. Detected in dendritic cells. Highly expressed in the Reed-Sternberg cells of Hodgkin disease. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 12q24.3

Cellular Component: centrosome; cytoplasm; cytosol; endosome; intermediate filament; kinetochore; microtubule; microtubule cytoskeleton

Molecular Function: microtubule binding; microtubule plus-end binding; protein binding; protein homodimerization activity; tubulin binding; zinc ion binding

Biological Process: microtubule bundle formation; mitosis; positive regulation of microtubule polymerization; sister chromatid cohesion

Research Articles on CLIP1

Similar Products

Product Notes

The CLIP1 clip1 (Catalog #AAA1273001) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtatgc taaagccaag tgggcttaag gcccccacca agatcctgaa gcctggaagc acagctctga agacacctac ggctgttgta gctccagtag aaaaaaccat atccagtgaa aaagcatcaa gcactccatc atctgagact caggaggaat ttgtggatga ctttcgagtt ggggagcgag tttgggtgaa tggaaataag cctggattta tccagtttct tggagaaacc cagtttgcac caggccagtg ggctggaatt gttttagatg aacccatagg caagaacgat ggttcggtgg caggagttcg gtatttccag tgtgaacctt taaagggcat atttacccga ccttcaaagt taacaaggaa ggtgcaagca gaagatgaag ctaatggcct gcagacaacg cccgcctccc gagctacttc accgctgtgc acttctacgg ccagcatggt gtcttcctcc ccctccaccc cttcaaacat ccctcagaaa ccatcacagc cagcagcaaa ggaaccttca gctacgcctc cgatcagcaa ccttacaaaa actgccagtg aatctatctc caacctttca gaggctggct caatcaagaa aggagaaaga gagctcaaaa tcggagacag agtattggtt ggtggcacta aggctggtgt agtccggttt cttggggaga ccgactttgc caagggggag tggtgtggcg tggagttaga tgagccactt gggaagaatg atggcgctgt tgctggaaca aggtattttc agtgtcaacc caaatatggc ttgttcgctc ctgtccacaa agttaccaag attggcttcc cttccactac accagccaaa gccaaggcca acgcagtgag gcgagtgatg gcgaccacgt ccgccagcct gaagcgcagc ccttctgcct cttccctcag ctccatgagc tcagtggcct cctctgtgag cagcaggccc agtcggacag gactagtaag gcccctttct cactacctgc ctccacttcc caggcaggat taa. It is sometimes possible for the material contained within the vial of "CLIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.