Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC2D cdna clone

CLEC2D cDNA Clone

Gene Names
CLEC2D; CLAX; LLT1; OCIL
Synonyms
CLEC2D; CLEC2D cDNA Clone; CLEC2D cdna clone
Ordering
For Research Use Only!
Sequence
atgcatgacagtaacaatgtggagaaagacattacaccatctgaattgcctgcaaacccaggttgtgtgcattcaaaagagcattctattaaagctaccttaatttggcgcttatttttcttaatcatgtttctgacaatcatagtgtgtggaatggttgctgctttaagtgcaataagagctaactgccatcaagagccatcagtatgtcttcaagctgcatgcccagaaagctggattggttttcaaagaaagtgtttctatttttctgatgacaccaagaactggacatcaagtcagaggttttgtgactcacaagatgctgatcttgctcaggttgaaagcttccaggaactgaatttcctgttgagatataaaggcccatctgatcactggattgggctgagcagagaacaaggccaaccatggaaatggataaatggtactgaatggacaagacagtaa
Sequence Length
465
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,823 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 2, member D, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 2 member D
NCBI Official Symbol
CLEC2D
NCBI Official Synonym Symbols
CLAX; LLT1; OCIL
NCBI Protein Information
C-type lectin domain family 2 member D
UniProt Protein Name
C-type lectin domain family 2 member D
UniProt Gene Name
CLEC2D
UniProt Synonym Gene Names
CLAX; LLT1; OCIL; LLT-1
UniProt Entry Name
CLC2D_HUMAN

NCBI Description

This gene encodes a member of the natural killer cell receptor C-type lectin family. The encoded protein inhibits osteoclast formation and contains a transmembrane domain near the N-terminus as well as the C-type lectin-like extracellular domain. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Oct 2010]

Uniprot Description

CLEC2D: Receptor for KLRB1 that protects target cells against natural killer cell-mediated lysis. Inhibits osteoclast formation. Inhibits bone resorption. Modulates the release of interferon- gamma. Binds high molecular weight sulfated glycosaminoglycans. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: cell surface; endoplasmic reticulum; integral to plasma membrane; membrane; plasma membrane

Molecular Function: transmembrane receptor activity

Biological Process: cell surface receptor linked signal transduction; regulation of immune response

Research Articles on CLEC2D

Similar Products

Product Notes

The CLEC2D clec2d (Catalog #AAA1267898) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatgaca gtaacaatgt ggagaaagac attacaccat ctgaattgcc tgcaaaccca ggttgtgtgc attcaaaaga gcattctatt aaagctacct taatttggcg cttatttttc ttaatcatgt ttctgacaat catagtgtgt ggaatggttg ctgctttaag tgcaataaga gctaactgcc atcaagagcc atcagtatgt cttcaagctg catgcccaga aagctggatt ggttttcaaa gaaagtgttt ctatttttct gatgacacca agaactggac atcaagtcag aggttttgtg actcacaaga tgctgatctt gctcaggttg aaagcttcca ggaactgaat ttcctgttga gatataaagg cccatctgat cactggattg ggctgagcag agaacaaggc caaccatgga aatggataaa tggtactgaa tggacaagac agtaa. It is sometimes possible for the material contained within the vial of "CLEC2D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.