Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC1B cdna clone

CLEC1B cDNA Clone

Gene Names
CLEC1B; CLEC2; CLEC2B; PRO1384; QDED721; 1810061I13Rik
Synonyms
CLEC1B; CLEC1B cDNA Clone; CLEC1B cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggatgaagatggatacatcaccttaaatattaaaactcggaaaccagctctcgtctccgctgtcatgcagcgcaattacctacaagatgagaatgaaaatcgcacaggaactctgcaacaattagcaaagcgcttctgtcaatatgtggtaaaacaatcagaactaaagggcactttcaaaggtcataaatgcagcccctgtgacacaaactggagatattatggagatagctgctatgggttcttcaggcacaacttaacatgggaagagagtaagcagtactgcactgacatgaatgctactctcctgaagattgacaaccggaacattgtggagtacatcaaagccaggactcatttaattcgttgggtcggattatctcgccagaagtcgaatgaggtctggaagtgggaggatggctcggttatctcagaaaatatgtttgagtttttggaagatggaaaaggaaatatgaattgtgcttattttcataatgggaaaatgcaccctaccttctgtgagaacaaacattatttaatgtgtgagaggaaggctggcatgaccaaggtggaccaactaccttaa
Sequence Length
591
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,096 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 1, member B, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 1 member B
NCBI Official Symbol
CLEC1B
NCBI Official Synonym Symbols
CLEC2; CLEC2B; PRO1384; QDED721; 1810061I13Rik
NCBI Protein Information
C-type lectin domain family 1 member B
UniProt Protein Name
C-type lectin domain family 1 member B
UniProt Gene Name
CLEC1B
UniProt Synonym Gene Names
CLEC2; CLEC-2
UniProt Entry Name
CLC1B_HUMAN

NCBI Description

Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]).[supplied by OMIM, Jan 2011]

Uniprot Description

CLEC1B: Acts as a receptor for the platelet-aggregating snake venom protein rhodocytin. Rhodocytin binding leads to tyrosine phosphorylation and this promotes the binding of spleen tyrosine kinase (Syk) and initiation of downstream tyrosine phosphorylation events and activation of PLC-gamma-2. Acts as an attachment factor for human immunodeficiency virus type 1 (HIV-1) and facilitates its capture by platelets. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 12p13.2

Cellular Component: plasma membrane

Molecular Function: protein binding; transmembrane receptor activity

Biological Process: cell surface receptor linked signal transduction; defense response; platelet activation

Research Articles on CLEC1B

Similar Products

Product Notes

The CLEC1B clec1b (Catalog #AAA1273103) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggatg aagatggata catcacctta aatattaaaa ctcggaaacc agctctcgtc tccgctgtca tgcagcgcaa ttacctacaa gatgagaatg aaaatcgcac aggaactctg caacaattag caaagcgctt ctgtcaatat gtggtaaaac aatcagaact aaagggcact ttcaaaggtc ataaatgcag cccctgtgac acaaactgga gatattatgg agatagctgc tatgggttct tcaggcacaa cttaacatgg gaagagagta agcagtactg cactgacatg aatgctactc tcctgaagat tgacaaccgg aacattgtgg agtacatcaa agccaggact catttaattc gttgggtcgg attatctcgc cagaagtcga atgaggtctg gaagtgggag gatggctcgg ttatctcaga aaatatgttt gagtttttgg aagatggaaa aggaaatatg aattgtgctt attttcataa tgggaaaatg caccctacct tctgtgagaa caaacattat ttaatgtgtg agaggaaggc tggcatgacc aaggtggacc aactacctta a. It is sometimes possible for the material contained within the vial of "CLEC1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.