Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CINP cdna clone

CINP cDNA Clone

Synonyms
CINP; CINP cDNA Clone; CINP cdna clone
Ordering
For Research Use Only!
Sequence
atggaagcaaagactcttggaactgtaacgcccagaaaacctgtcttatctgtcagtgcaagaaaaattaaggacaatgcggctgattggcacaatttaatcctgaagtgggaaaccctcaatgatgcaggttttaccactgcaaataatattgccaacttgaaaatcagtttattgaataaagacaagatagaactagacagcagcagcccagcctcgaaggaaaatgaagaaaaggtgtgtctggaatataacgaggaactggagaagctgtgtgaggaactgcaggccaccttggatgggttgaccaaaatacaggtgaaaatggaaaagctgtcttcaactaccaagggaatttgtgaactagaaaactaccattatggggaggagagtaaacgaccccctctgttccacacgtggcctacaacccatttctatgaggtttcgcataagctcttggagatgtacaggaaggagctgctcctgaagcgcacggtggccaaggagcttgcccacaccggggatcccgacctcaccctgagctacctgtccatgtggctgcaccagccctatgtggagagcgacagtaggctgcatctggagagcatgctgctggagacaggccaccgagctctctga
Sequence Length
639
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,051 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 2-interacting protein, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 2 interacting protein
NCBI Official Symbol
CINP
NCBI Protein Information
cyclin-dependent kinase 2-interacting protein
UniProt Protein Name
Cyclin-dependent kinase 2-interacting protein
UniProt Gene Name
CINP
UniProt Synonym Gene Names
CDK2-interacting protein
UniProt Entry Name
CINP_HUMAN

NCBI Description

The protein encoded by this gene is reported to be a component of the DNA replication complex as well as a genome-maintenance protein. It may interact with proteins important for replication initiation and has been shown to bind chromatin at the G1 phase of the cell cycle and dissociate from chromatin with replication initiation. It may also serve to regulate checkpoint signaling as part of the DNA damage response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

CINP: Interacts with the components of the replication complex and 2 kinases, CDK2 and CDC7, thereby providing a functional and physical link between CDK2 and CDC7 during firing of the origins of replication. Regulates ATR-mediated checkpoint signaling. Belongs to the CINP family.

Protein type: Cell cycle regulation; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 14q32.31

Molecular Function: protein binding

Research Articles on CINP

Similar Products

Product Notes

The CINP cinp (Catalog #AAA1267445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcaa agactcttgg aactgtaacg cccagaaaac ctgtcttatc tgtcagtgca agaaaaatta aggacaatgc ggctgattgg cacaatttaa tcctgaagtg ggaaaccctc aatgatgcag gttttaccac tgcaaataat attgccaact tgaaaatcag tttattgaat aaagacaaga tagaactaga cagcagcagc ccagcctcga aggaaaatga agaaaaggtg tgtctggaat ataacgagga actggagaag ctgtgtgagg aactgcaggc caccttggat gggttgacca aaatacaggt gaaaatggaa aagctgtctt caactaccaa gggaatttgt gaactagaaa actaccatta tggggaggag agtaaacgac cccctctgtt ccacacgtgg cctacaaccc atttctatga ggtttcgcat aagctcttgg agatgtacag gaaggagctg ctcctgaagc gcacggtggc caaggagctt gcccacaccg gggatcccga cctcaccctg agctacctgt ccatgtggct gcaccagccc tatgtggaga gcgacagtag gctgcatctg gagagcatgc tgctggagac aggccaccga gctctctga. It is sometimes possible for the material contained within the vial of "CINP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.