Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHRNA6 cdna clone

CHRNA6 cDNA Clone

Gene Names
CHRNA6; CHNRA6
Synonyms
CHRNA6; CHRNA6 cDNA Clone; CHRNA6 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgaccagcaaggggcagggattccttcatgggggcttgtgtctctggctgtgtgtgttcacacctttctttaaaggctgtgtgggctgtgcaactgaggagaggctcttccacaaactgttttctcattacaaccagttcatcaggcctgtggaaaacgtttccgaccctgtcacggtacactttgaagtggccatcacccagctggccaacgtggatgaagtaaaccagatcatggaaaccaatttgtggctgcgtcacatctggaatgattataaattgcgctgggatccaatggaatatgatggcattgagactcttcgcgttcctgcagataagatttggaagcccgacattgttctctataacaatgctgttggtgacttccaagtagaaggcaaaacaaaagctcttcttaaatacaatggcatgataacctggactccaccagctatttttaagagttcctgccctatggatatcacctttttcccttttgatcatcaaaactgttccctaaaatttggttcctggacgtatgacaaagctgaaattgatcttctaatcattggatcaaaagtggatatgaatgatttttgggaaaacagtgaatgggaaatcattgatgcctctggctacaaacatgacatcaaatacaactgttgtgaagagatatacacagatataacctattctttctacattagaagattgccgatgttttacacgattaatctgatcatcccttgtctctttatttcatttctaaccgtgttggtcttttaccttccttcggactgtggtgaaaaagtgacgctttgtatttcagtcctgctttctctgactgtgtttttgctggtcatcacagaaaccatcccatccacatctctggtggtcccactggtgggtgagtacctgctgttcaccatgatctttgtcacactgtccatcgtggtgactgtgtttgtgttgaacatacactaccgcaccccaaccacgcacacaatgcccaggtgggtgaagacagttttcctgaagctgctgccccaggtcctgctgatgaggtggcctctggacaagacaaggggcacaggctctgatgcagtgcccagaggccttgccaggaggcctgccaaaggcaagcttgcaagccatggggaacccagacatcttaaagaatgcttccattgtcacaaatcaaatgagcttgccacaagcaagagaagattaagtcatcagccattacagtgggtggtggaaaattcggagcactcgcctgaagttgaagatgtgattaacagtgttcagttcatagcagaaaacatgaagagccacaatgaaaccaaggaggtagaagatgactggaaatacgtggccatggtggtggacagagtatttctttgggtatttataattgtctgtgtatttggaactgcagggctatttctacagccactacttgggaacacaggaaaatcttaa
Sequence Length
1485
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,018 Da
NCBI Official Full Name
Homo sapiens cholinergic receptor, nicotinic, alpha 6, mRNA
NCBI Official Synonym Full Names
cholinergic receptor nicotinic alpha 6 subunit
NCBI Official Symbol
CHRNA6
NCBI Official Synonym Symbols
CHNRA6
NCBI Protein Information
neuronal acetylcholine receptor subunit alpha-6
UniProt Protein Name
Neuronal acetylcholine receptor subunit alpha-6
UniProt Gene Name
CHRNA6
UniProt Entry Name
ACHA6_HUMAN

NCBI Description

This gene encodes an alpha subunit of neuronal nicotinic acetylcholine receptors. These receptors consist of five subunits and function as ion channels involved in neurotransmission. The encoded protein is a subunit of neuronal nicotinic acetylcholine receptors that mediate dopaminergic neurotransmission and are activated by acetylcholine and exogenous nicotine. Alternatively spliced transcript variants have been observed for this gene. Single nucleotide polymorphisms in this gene have been associated with both nicotine and alcohol dependence. [provided by RefSeq, Dec 2010]

Uniprot Description

nAChRA6: After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. Belongs to the ligand-gated ion channel (TC 1.A.9) family. Acetylcholine receptor (TC 1.A.9.1) subfamily. Alpha- 6/CHRNA6 sub-subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Channel, ligand-gated; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 8p11.21

Cellular Component: plasma membrane

Molecular Function: acetylcholine binding; acetylcholine receptor activity; ligand-gated ion channel activity

Biological Process: neuromuscular synaptic transmission; response to nicotine; signal transduction; synaptic transmission; synaptic transmission, cholinergic; transport

Research Articles on CHRNA6

Similar Products

Product Notes

The CHRNA6 chrna6 (Catalog #AAA1266651) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgacca gcaaggggca gggattcctt catgggggct tgtgtctctg gctgtgtgtg ttcacacctt tctttaaagg ctgtgtgggc tgtgcaactg aggagaggct cttccacaaa ctgttttctc attacaacca gttcatcagg cctgtggaaa acgtttccga ccctgtcacg gtacactttg aagtggccat cacccagctg gccaacgtgg atgaagtaaa ccagatcatg gaaaccaatt tgtggctgcg tcacatctgg aatgattata aattgcgctg ggatccaatg gaatatgatg gcattgagac tcttcgcgtt cctgcagata agatttggaa gcccgacatt gttctctata acaatgctgt tggtgacttc caagtagaag gcaaaacaaa agctcttctt aaatacaatg gcatgataac ctggactcca ccagctattt ttaagagttc ctgccctatg gatatcacct ttttcccttt tgatcatcaa aactgttccc taaaatttgg ttcctggacg tatgacaaag ctgaaattga tcttctaatc attggatcaa aagtggatat gaatgatttt tgggaaaaca gtgaatggga aatcattgat gcctctggct acaaacatga catcaaatac aactgttgtg aagagatata cacagatata acctattctt tctacattag aagattgccg atgttttaca cgattaatct gatcatccct tgtctcttta tttcatttct aaccgtgttg gtcttttacc ttccttcgga ctgtggtgaa aaagtgacgc tttgtatttc agtcctgctt tctctgactg tgtttttgct ggtcatcaca gaaaccatcc catccacatc tctggtggtc ccactggtgg gtgagtacct gctgttcacc atgatctttg tcacactgtc catcgtggtg actgtgtttg tgttgaacat acactaccgc accccaacca cgcacacaat gcccaggtgg gtgaagacag ttttcctgaa gctgctgccc caggtcctgc tgatgaggtg gcctctggac aagacaaggg gcacaggctc tgatgcagtg cccagaggcc ttgccaggag gcctgccaaa ggcaagcttg caagccatgg ggaacccaga catcttaaag aatgcttcca ttgtcacaaa tcaaatgagc ttgccacaag caagagaaga ttaagtcatc agccattaca gtgggtggtg gaaaattcgg agcactcgcc tgaagttgaa gatgtgatta acagtgttca gttcatagca gaaaacatga agagccacaa tgaaaccaag gaggtagaag atgactggaa atacgtggcc atggtggtgg acagagtatt tctttgggta tttataattg tctgtgtatt tggaactgca gggctatttc tacagccact acttgggaac acaggaaaat cttaa. It is sometimes possible for the material contained within the vial of "CHRNA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.