Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHAC2 cdna clone

CHAC2 cDNA Clone

Synonyms
CHAC2; CHAC2 cDNA Clone; CHAC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgggtttttggttacgggtccctgatctggaaggtggatttcccctatcaggacaagctggtcggatacatcaccaactacagcaggcgcttctggcagggcagcacggaccaccgcggggtccccggcaagcctggaagagttgtgactcttgttgaagatcctgcgggatgtgtatggggtgttgcttacagattgccagtaggaaaggaagaagaagtaaaagcataccttgacttcagagaaaaaggaggctacagaaccacaacagtcattttttatccaaaagatcccacaacaaaaccattcagtgtattgctatatattggaacatgtgataatcctgattatcttggtcctgcacctctggaagacattgctgaacaaatttttaatgcagctggtccaagtggaagaaatacagaatatctttttgaacttgcaaattctattaggaaccttgtgccagaagaagcagatgagcatcttttcgctttggaaaaattagtaaaggaacgtttagaagggaaacagaacctcaattgcatataa
Sequence Length
555
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,875 Da
NCBI Official Full Name
Homo sapiens ChaC, cation transport regulator homolog 2 (E. coli), mRNA
NCBI Official Synonym Full Names
ChaC cation transport regulator homolog 2
NCBI Official Symbol
CHAC2
NCBI Protein Information
putative glutathione-specific gamma-glutamylcyclotransferase 2
UniProt Protein Name
Putative glutathione-specific gamma-glutamylcyclotransferase 2
UniProt Gene Name
CHAC2
UniProt Synonym Gene Names
Gamma-GCG 2
UniProt Entry Name
CHAC2_HUMAN

Uniprot Description

CHAC2: Belongs to the chaC family.

Chromosomal Location of Human Ortholog: 2p16

Cellular Component: cytosol

Molecular Function: gamma-glutamylcyclotransferase activity

Biological Process: glutathione biosynthetic process

Similar Products

Product Notes

The CHAC2 chac2 (Catalog #AAA1276520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggttt ttggttacgg gtccctgatc tggaaggtgg atttccccta tcaggacaag ctggtcggat acatcaccaa ctacagcagg cgcttctggc agggcagcac ggaccaccgc ggggtccccg gcaagcctgg aagagttgtg actcttgttg aagatcctgc gggatgtgta tggggtgttg cttacagatt gccagtagga aaggaagaag aagtaaaagc ataccttgac ttcagagaaa aaggaggcta cagaaccaca acagtcattt tttatccaaa agatcccaca acaaaaccat tcagtgtatt gctatatatt ggaacatgtg ataatcctga ttatcttggt cctgcacctc tggaagacat tgctgaacaa atttttaatg cagctggtcc aagtggaaga aatacagaat atctttttga acttgcaaat tctattagga accttgtgcc agaagaagca gatgagcatc ttttcgcttt ggaaaaatta gtaaaggaac gtttagaagg gaaacagaac ctcaattgca tataa. It is sometimes possible for the material contained within the vial of "CHAC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.