Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CETN3 cdna clone

CETN3 cDNA Clone

Gene Names
CETN3; CEN3; CDC31
Synonyms
CETN3; CETN3 cDNA Clone; CETN3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtttagctctgagaagtgagcttgtagtggacaaaacaaagaggaaaaaaagaagagaactgtctgaggaacagaaacaagaaattaaagatgcttttgaactatttgatacagacaaagatgaagcaatagattatcatgaattaaaggtggcaatgagagccttggggtttgatgtaaaaaaagctgatgtactgaagattcttaaagattatgacagagaagccacagggaaaatcacctttgaagattttaatgaagttgtgacagactggatattggaaagagatccccatgaagaaatactcaaggcatttaaactatttgatgatgatgattcaggtaaaataagcttgaggaatttgcgacgtgttgctagagaattgggtgaaaacatgagtgatgaagaacttcgagctatgatagaagaatttgacaaagatggtgatggagaaataaaccaagaggagttcattgctattatgactggtgacatttaa
Sequence Length
504
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,550 Da
NCBI Official Full Name
Homo sapiens centrin, EF-hand protein, 3 (CDC31 homolog, yeast), mRNA
NCBI Official Synonym Full Names
centrin 3
NCBI Official Symbol
CETN3
NCBI Official Synonym Symbols
CEN3; CDC31
NCBI Protein Information
centrin-3
UniProt Protein Name
Centrin-3
Protein Family
UniProt Gene Name
CETN3
UniProt Synonym Gene Names
CEN3
UniProt Entry Name
CETN3_HUMAN

NCBI Description

The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

CETN3: Plays a fundamental role in microtubule-organizing center structure and function. Belongs to the centrin family.

Chromosomal Location of Human Ortholog: 5q14.3

Cellular Component: centriole; centrosome

Molecular Function: protein binding

Biological Process: centrosome cycle

Research Articles on CETN3

Similar Products

Product Notes

The CETN3 cetn3 (Catalog #AAA1277367) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtttag ctctgagaag tgagcttgta gtggacaaaa caaagaggaa aaaaagaaga gaactgtctg aggaacagaa acaagaaatt aaagatgctt ttgaactatt tgatacagac aaagatgaag caatagatta tcatgaatta aaggtggcaa tgagagcctt ggggtttgat gtaaaaaaag ctgatgtact gaagattctt aaagattatg acagagaagc cacagggaaa atcacctttg aagattttaa tgaagttgtg acagactgga tattggaaag agatccccat gaagaaatac tcaaggcatt taaactattt gatgatgatg attcaggtaa aataagcttg aggaatttgc gacgtgttgc tagagaattg ggtgaaaaca tgagtgatga agaacttcga gctatgatag aagaatttga caaagatggt gatggagaaa taaaccaaga ggagttcatt gctattatga ctggtgacat ttaa. It is sometimes possible for the material contained within the vial of "CETN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.