Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CETN2 cdna clone

CETN2 cDNA Clone

Gene Names
CETN2; CALT; CEN2
Synonyms
CETN2; CETN2 cDNA Clone; CETN2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctccaactttaagaaggcaaacatggcatcaagttctcagcgaaaaagaatgagccctaagcctgagcttactgaagagcaaaagcaggagatccgggaagcttttgatcttttcgatgcggatggaactggcaccatagatgttaaagaactgaaggtggcaatgagggccctgggctttgaacccaagaaagaagaaattaagaaaatgataagtgaaattgataaggaagggacaggaaaaatgaactttggtgactttttaactgtgatgacccagaaaatgtctgagaaagatactaaagaagaaatcctgaaagctttcaagctctttgatgatgatgaaactgggaagatttcgttcaaaaatctgaaacgcgtggccaaggagttgggtgagaacctgactgatgaggagctgcaggaaatgattgatgaagctgatcgagatggagatggagaggtcagtgagcaagagttcctgcgcatcatgaaaaagaccagcctctattaa
Sequence Length
519
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,738 Da
NCBI Official Full Name
Homo sapiens centrin, EF-hand protein, 2, mRNA
NCBI Official Synonym Full Names
centrin 2
NCBI Official Symbol
CETN2
NCBI Official Synonym Symbols
CALT; CEN2
NCBI Protein Information
centrin-2
UniProt Protein Name
Centrin-2
Protein Family
UniProt Gene Name
CETN2
UniProt Synonym Gene Names
CALT; CEN2
UniProt Entry Name
CETN2_HUMAN

NCBI Description

Caltractin belongs to a family of calcium-binding proteins and is a structural component of the centrosome. The high level of conservation from algae to humans and its association with the centrosome suggested that caltractin plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome. [provided by RefSeq, Jul 2008]

Uniprot Description

CETN2: a calcium-binding proteins and is a structural component of the centrosome. Contains 4 EF-hand calcium-binding domains. Highly conserved from algae to humans. Its association with the centrosome suggests that it plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome.

Protein type: Cell cycle regulation; Calcium-binding; DNA repair, damage

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: centriole; centrosome; cytosol; intracellular; nucleoplasm

Molecular Function: protein binding

Biological Process: centriole replication; G2/M transition of mitotic cell cycle; nucleotide-excision repair; nucleotide-excision repair, DNA damage recognition; nucleotide-excision repair, DNA duplex unwinding; nucleotide-excision repair, preincision complex assembly; protein sumoylation; regulation of cytokinesis

Research Articles on CETN2

Similar Products

Product Notes

The CETN2 cetn2 (Catalog #AAA1270806) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcca actttaagaa ggcaaacatg gcatcaagtt ctcagcgaaa aagaatgagc cctaagcctg agcttactga agagcaaaag caggagatcc gggaagcttt tgatcttttc gatgcggatg gaactggcac catagatgtt aaagaactga aggtggcaat gagggccctg ggctttgaac ccaagaaaga agaaattaag aaaatgataa gtgaaattga taaggaaggg acaggaaaaa tgaactttgg tgacttttta actgtgatga cccagaaaat gtctgagaaa gatactaaag aagaaatcct gaaagctttc aagctctttg atgatgatga aactgggaag atttcgttca aaaatctgaa acgcgtggcc aaggagttgg gtgagaacct gactgatgag gagctgcagg aaatgattga tgaagctgat cgagatggag atggagaggt cagtgagcaa gagttcctgc gcatcatgaa aaagaccagc ctctattaa. It is sometimes possible for the material contained within the vial of "CETN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.