Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDK4 cdna clone

CDK4 cDNA Clone

Gene Names
CDK4; CMM3; PSK-J3
Synonyms
CDK4; CDK4 cDNA Clone; CDK4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctacctctcgatatgagccagtggctgaaattggtgtcggtgcctatgggacagtgtacaaggcccgtgatccccacagtggccactttgtggccctcaagagtgtgagagtccccaatggaggaggaggtggaggaggccttcccatcagcacagttcgtgaggtggctttactgaggcgactggaggcttttgagcatcccaatgttgtccggctgatggacgtctgtgccacatcccgaactgaccgggagatcaaggtaaccctggtgtttgagcatgtagaccaggacctaaggacatatctggacaaggcacccccaccaggcttgccagccgaaacgatcaaggatctgatgcgccagtttctaagaggcctagatttccttcatgccaattgcatcgttcaccgagatctgaagccagagaacattctggtgacaagtggtggaacagtcaagctggctgactttggcctggccagaatctacagctaccagatggcacttacacccgtggttgttacactctggtaccgagctcccgaagttcttctgcagtccacatatgcaacacctgtggacatgtggagtgttggctgtatctttgcagagatgtttcgtcgaaagcctctcttctgtggaaactctgaagccgaccagttgggcaaaatctttgacctgattgggctgcctccagaggatgactggcctcgagatgtatccctgccccgtggagcctttccccccagagggccccgcccagtgcagtcggtggtacctgagatggaggagtcgggagcacagctgctgctggaaatgctgacttttaacccacacaagcgaatctctgcctttcgagctctgcagcactcttatctacataaggatgaaggtaatccggagtga
Sequence Length
912
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,725 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 4, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 4
NCBI Official Symbol
CDK4
NCBI Official Synonym Symbols
CMM3; PSK-J3
NCBI Protein Information
cyclin-dependent kinase 4
UniProt Protein Name
Cyclin-dependent kinase 4
Protein Family
UniProt Gene Name
CDK4
UniProt Entry Name
CDK4_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

CDK4: a protein kinase of the CDK family that is important for cell cycle G1 phase progression. Its activity is restricted to the G1-S phase. Controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). Phosphorylates the retinoblastoma gene product (Rb). Point mutations found in somatic and familial melanoma. Amplified in sarcomas, glioma and lymphoma. Amplified, methylated or deleted in head and neck squamous cell carcinoma. Overexpression drives epithelial tumors in mice. Disruption makes mice resistant to cancer. Inhibitor: PD332991.

Protein type: Protein kinase, CMGC; Cell cycle regulation; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; EC 2.7.11.22; CMGC group; CDK family; CDK/CDK4 subfamily; CDK4 subfamily

Chromosomal Location of Human Ortholog: 12q14

Cellular Component: chromatin; cyclin-dependent protein kinase holoenzyme complex; cytosol; nuclear membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: cyclin binding; cyclin-dependent protein kinase activity; cyclin-dependent protein kinase regulator activity; protein binding

Biological Process: G1/S transition of mitotic cell cycle; positive regulation of cell cycle; positive regulation of cell proliferation; positive regulation of fibroblast proliferation; protein amino acid phosphorylation; regulation of gene expression; response to drug

Disease: Melanoma, Cutaneous Malignant, Susceptibility To, 3

Research Articles on CDK4

Similar Products

Product Notes

The CDK4 cdk4 (Catalog #AAA1272081) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctacct ctcgatatga gccagtggct gaaattggtg tcggtgccta tgggacagtg tacaaggccc gtgatcccca cagtggccac tttgtggccc tcaagagtgt gagagtcccc aatggaggag gaggtggagg aggccttccc atcagcacag ttcgtgaggt ggctttactg aggcgactgg aggcttttga gcatcccaat gttgtccggc tgatggacgt ctgtgccaca tcccgaactg accgggagat caaggtaacc ctggtgtttg agcatgtaga ccaggaccta aggacatatc tggacaaggc acccccacca ggcttgccag ccgaaacgat caaggatctg atgcgccagt ttctaagagg cctagatttc cttcatgcca attgcatcgt tcaccgagat ctgaagccag agaacattct ggtgacaagt ggtggaacag tcaagctggc tgactttggc ctggccagaa tctacagcta ccagatggca cttacacccg tggttgttac actctggtac cgagctcccg aagttcttct gcagtccaca tatgcaacac ctgtggacat gtggagtgtt ggctgtatct ttgcagagat gtttcgtcga aagcctctct tctgtggaaa ctctgaagcc gaccagttgg gcaaaatctt tgacctgatt gggctgcctc cagaggatga ctggcctcga gatgtatccc tgccccgtgg agcctttccc cccagagggc cccgcccagt gcagtcggtg gtacctgaga tggaggagtc gggagcacag ctgctgctgg aaatgctgac ttttaaccca cacaagcgaa tctctgcctt tcgagctctg cagcactctt atctacataa ggatgaaggt aatccggagt ga. It is sometimes possible for the material contained within the vial of "CDK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.