Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDK10 cdna clone

CDK10 cDNA Clone

Gene Names
CDK10; PISSLRE
Synonyms
CDK10; CDK10 cDNA Clone; CDK10 cdna clone
Ordering
For Research Use Only!
Sequence
atggacaaggagaaggatggcatccccatcagcagcttgcgggagatcacgctgctgctccgcctgcgtcatccgaacatcgtggagctgaaggaggtggttgtggggaaccacctggagagcatcttcctggtgatgggttactgtgagcaggacctggccagcctcctggagaatatgccaacacccttctcggaggctcaggtcaagtgcatcgtgctgcaggtgctccggggcctccagtatctgcacaggaacttcattatccacagggacctgaaggtttccaacttgctcatgaccgacaagggttgtgtgaagacagcggatttcggcctggcccgggcctatggtgtcccagtaaagccaatgacccccaaggtggtcactctctggtaccgagcccctgaactgctgttgggaaccaccacgcagaccaccagcatcgacatgtgggctgtgggctgcatactggccgagctgctggcgcacaggcctcttctccccggcacttccgagatccaccagatcgacttgatcgtgcagctgctgggcacgcccagtgagaacatctggccgggcttttccaagctgccactggtcggccagtacagcctccggaagcagccctacaacaacctgaagcacaagttcccatggctgtcggaggccgggctgcgcctgctgcacttcctgttcatggcgacggccggggactgcctggagagctcctatttcaaggagaagcccctaccctgtgagccggagctcatgccgacctttccccaccaccgcaacaagcgggccgccccagccacctccgagggccagagcaagcgctgtaaaccctga
Sequence Length
852
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,662 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 10, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 10
NCBI Official Symbol
CDK10
NCBI Official Synonym Symbols
PISSLRE
NCBI Protein Information
cyclin-dependent kinase 10
UniProt Protein Name
Cyclin-dependent kinase 10
Protein Family
UniProt Gene Name
CDK10
UniProt Entry Name
CDK10_HUMAN

NCBI Description

The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

Uniprot Description

CDK10: a CMGC kinase of the CDK family. Plays a role in cellular proliferation. Its function is limited to cell cycle G2-M phase. At least three alternatively spliced isoforms have been reported, two of which contain multiple non-AUG translation initiation sites.

Protein type: Protein kinase, CMGC; EC 2.7.11.22; Protein kinase, Ser/Thr (non-receptor); Cell cycle regulation; Kinase, protein; CMGC group; CDK family; CDK/CDK10 subfamily; CDK10 subfamily

Chromosomal Location of Human Ortholog: 16q24

Molecular Function: protein binding

Biological Process: negative regulation of cell proliferation; traversing start control point of mitotic cell cycle

Research Articles on CDK10

Similar Products

Product Notes

The CDK10 cdk10 (Catalog #AAA1266177) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaagg agaaggatgg catccccatc agcagcttgc gggagatcac gctgctgctc cgcctgcgtc atccgaacat cgtggagctg aaggaggtgg ttgtggggaa ccacctggag agcatcttcc tggtgatggg ttactgtgag caggacctgg ccagcctcct ggagaatatg ccaacaccct tctcggaggc tcaggtcaag tgcatcgtgc tgcaggtgct ccggggcctc cagtatctgc acaggaactt cattatccac agggacctga aggtttccaa cttgctcatg accgacaagg gttgtgtgaa gacagcggat ttcggcctgg cccgggccta tggtgtccca gtaaagccaa tgacccccaa ggtggtcact ctctggtacc gagcccctga actgctgttg ggaaccacca cgcagaccac cagcatcgac atgtgggctg tgggctgcat actggccgag ctgctggcgc acaggcctct tctccccggc acttccgaga tccaccagat cgacttgatc gtgcagctgc tgggcacgcc cagtgagaac atctggccgg gcttttccaa gctgccactg gtcggccagt acagcctccg gaagcagccc tacaacaacc tgaagcacaa gttcccatgg ctgtcggagg ccgggctgcg cctgctgcac ttcctgttca tggcgacggc cggggactgc ctggagagct cctatttcaa ggagaagccc ctaccctgtg agccggagct catgccgacc tttccccacc accgcaacaa gcgggccgcc ccagccacct ccgagggcca gagcaagcgc tgtaaaccct ga. It is sometimes possible for the material contained within the vial of "CDK10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.