Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDH16 cdna clone

CDH16 cDNA Clone

Synonyms
CDH16; CDH16 cDNA Clone; CDH16 cdna clone
Ordering
For Research Use Only!
Sequence
atggtccctgcctggctgtggctgctttgtgtctccgtcccccaggctctccccaaggcccagcctgcagagctgtctgtggaagttccagaaaactatggtggaaatttccctttatacctgaccaagttgccgctgccccgtgagggggctgaaggccagatcgtgctgtcaggggactcaggcaaggcaactgagggcccatttgctatggatccagattctggcttcctgctggtgaccagggccctggaccgagaggagcaggcagagtaccagctacaggtcaccctggagatgcaggatggacatgtcttgtggggtccacagcctgtgcttgtgcacgtgaaggatgagaatgaccaggtgccccatttctctcaagccatctacagagctcggctgagccggggtaccaggcctggcatccccttcctcttccttgaggcttcagaccgggatgagccaggcacagccaactcggatcttcgattccacatcctgagccaggctccagcccagccttccccagacatgttccagctggagcctcggctgggggctctggccctcagccccaaggggagcaccagccttgaccacgccctggagaggacctaccagctgttggtacaggtcaaggacatgggtgaccaggcctcaggccaccaggccactgccaccgtggaagtctccatcatagagagcacctgggtgtccctagagcctatccacctggcagagaatctcaaagtcctatacccgcaccacatggcccaggtacactggagtgggggtgatgtgcactatcacctggagagccatcccccgggaccctttgaagtgaatgcagagggaaacctctacgtgaccagagagctggacagagaagcccaggctgagtacctgctccaggtgcgggctcagaattcccatggcgaggactatgcggcccctctggagctgcacgtgctggtgatggatgagaatgacaacgtgcctatctgccctccccgtgaccccacagtcagcatccctgagctcagtccaccaggtactgaagtgactagactgtcagcagaggatgcagatgcccccggctcccccaattcccacgttgtgtatcagctcctgagccctgagcctgaggatggggtagaggggagagccttccaggtggaccccacttcaggcagtgtgacgctgggggtgctcccactccgagcaggccagaacatcctgcttctggtgctggccatggacctggcaggcgcagagggtggcttcagcagcacgtgtgaagtcgaagtcgcagtcacagatatcaatgatcacgcccctgagttcatcacttcccagattgggcctataagcctccctgaggatgtggagcccgggactctggtggccatgctaacagccattgatgctgacctcgagcccgccttccgcctcatggattttgccattgagaggggagacacagaagggacttttggcctggattgggagccagactctgggcatgttagactcagactctgcaagaacctcagttatgaggcagctccaagtcatgaggtggtggtggtggtgcagagtgtggcgaagctggtggggccaggcccaggccctggagccaccgccacggtgactgtgctagtggagagagtgatgccaccccccaagttggaccaggagagctacgaggccagtgtccccatcagtgccccagccggctctttcctgctgaccatccagccctccgaccccatcagccgaaccctcaggttctccctagtcaatgactcagagggctggctctgcattgagaaattctccggggaggtgcacaccgcccagtccctgcagggcgcccagcctggggacacctacacggtgcttgtggaggcccaggatacagatgagccgagactgagcgcttctgcacccctggtgatccacttcctaaaggcccctcctgccccagccctgactcttgcccctgtgccctcccaatacctctgcacaccccgccaagaccatggcttgatcgtgagtggacccagcaaggaccccgatctggccagtgggcacggtccctacagcttcacccttggtcccaaccccacggtgcaacgggattggcgcctccagactctcaatggttcccatgcctacctcaccttggccctgcattgggtggagccacgtgaacacataatccccgtggtggtcagccacaatgcccagatgtggcagctcctggttcgagtgatcgtgtgtcgctgcaacgtggaggggcagtgcatgcgcaaggtgggccgcatgaagggcatgcccacgaagctgtcggcagtgggcatccttgtaggcaccctggtagcaataggaatcttcctcatcctcattttcacccactggaccatgtcaaggaagaaggacccggatcaaccagcagacagcgtgcccctgaaggcgactgtctga
Sequence Length
2490
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,774 Da
NCBI Official Full Name
Homo sapiens cadherin 16, KSP-cadherin, mRNA
NCBI Official Synonym Full Names
cadherin 16
NCBI Official Symbol
CDH16
NCBI Protein Information
cadherin-16
UniProt Protein Name
Cadherin-16
Protein Family
UniProt Gene Name
CDH16
UniProt Synonym Gene Names
Ksp-cadherin
UniProt Entry Name
CAD16_HUMAN

NCBI Description

This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]

Uniprot Description

CDH16: Cadherins are calcium-dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 16q22.1

Biological Process: cell adhesion

Research Articles on CDH16

Similar Products

Product Notes

The CDH16 cdh16 (Catalog #AAA1275451) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtccctg cctggctgtg gctgctttgt gtctccgtcc cccaggctct ccccaaggcc cagcctgcag agctgtctgt ggaagttcca gaaaactatg gtggaaattt ccctttatac ctgaccaagt tgccgctgcc ccgtgagggg gctgaaggcc agatcgtgct gtcaggggac tcaggcaagg caactgaggg cccatttgct atggatccag attctggctt cctgctggtg accagggccc tggaccgaga ggagcaggca gagtaccagc tacaggtcac cctggagatg caggatggac atgtcttgtg gggtccacag cctgtgcttg tgcacgtgaa ggatgagaat gaccaggtgc cccatttctc tcaagccatc tacagagctc ggctgagccg gggtaccagg cctggcatcc ccttcctctt ccttgaggct tcagaccggg atgagccagg cacagccaac tcggatcttc gattccacat cctgagccag gctccagccc agccttcccc agacatgttc cagctggagc ctcggctggg ggctctggcc ctcagcccca aggggagcac cagccttgac cacgccctgg agaggaccta ccagctgttg gtacaggtca aggacatggg tgaccaggcc tcaggccacc aggccactgc caccgtggaa gtctccatca tagagagcac ctgggtgtcc ctagagccta tccacctggc agagaatctc aaagtcctat acccgcacca catggcccag gtacactgga gtgggggtga tgtgcactat cacctggaga gccatccccc gggacccttt gaagtgaatg cagagggaaa cctctacgtg accagagagc tggacagaga agcccaggct gagtacctgc tccaggtgcg ggctcagaat tcccatggcg aggactatgc ggcccctctg gagctgcacg tgctggtgat ggatgagaat gacaacgtgc ctatctgccc tccccgtgac cccacagtca gcatccctga gctcagtcca ccaggtactg aagtgactag actgtcagca gaggatgcag atgcccccgg ctcccccaat tcccacgttg tgtatcagct cctgagccct gagcctgagg atggggtaga ggggagagcc ttccaggtgg accccacttc aggcagtgtg acgctggggg tgctcccact ccgagcaggc cagaacatcc tgcttctggt gctggccatg gacctggcag gcgcagaggg tggcttcagc agcacgtgtg aagtcgaagt cgcagtcaca gatatcaatg atcacgcccc tgagttcatc acttcccaga ttgggcctat aagcctccct gaggatgtgg agcccgggac tctggtggcc atgctaacag ccattgatgc tgacctcgag cccgccttcc gcctcatgga ttttgccatt gagaggggag acacagaagg gacttttggc ctggattggg agccagactc tgggcatgtt agactcagac tctgcaagaa cctcagttat gaggcagctc caagtcatga ggtggtggtg gtggtgcaga gtgtggcgaa gctggtgggg ccaggcccag gccctggagc caccgccacg gtgactgtgc tagtggagag agtgatgcca ccccccaagt tggaccagga gagctacgag gccagtgtcc ccatcagtgc cccagccggc tctttcctgc tgaccatcca gccctccgac cccatcagcc gaaccctcag gttctcccta gtcaatgact cagagggctg gctctgcatt gagaaattct ccggggaggt gcacaccgcc cagtccctgc agggcgccca gcctggggac acctacacgg tgcttgtgga ggcccaggat acagatgagc cgagactgag cgcttctgca cccctggtga tccacttcct aaaggcccct cctgccccag ccctgactct tgcccctgtg ccctcccaat acctctgcac accccgccaa gaccatggct tgatcgtgag tggacccagc aaggaccccg atctggccag tgggcacggt ccctacagct tcacccttgg tcccaacccc acggtgcaac gggattggcg cctccagact ctcaatggtt cccatgccta cctcaccttg gccctgcatt gggtggagcc acgtgaacac ataatccccg tggtggtcag ccacaatgcc cagatgtggc agctcctggt tcgagtgatc gtgtgtcgct gcaacgtgga ggggcagtgc atgcgcaagg tgggccgcat gaagggcatg cccacgaagc tgtcggcagt gggcatcctt gtaggcaccc tggtagcaat aggaatcttc ctcatcctca ttttcaccca ctggaccatg tcaaggaaga aggacccgga tcaaccagca gacagcgtgc ccctgaaggc gactgtctga. It is sometimes possible for the material contained within the vial of "CDH16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.