Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDCA4 cdna clone

CDCA4 cDNA Clone

Gene Names
CDCA4; HEPP; SEI-3/HEPP
Synonyms
CDCA4; CDCA4 cDNA Clone; CDCA4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttgcacgaggactgaagaggaaatgtgttggccacgaggaagacgtggagggagccctggccggcttgaagacagtgtcctcatacagcctgcagcggcagtcgctcctggacatgtctctggtgaagttgcagctttgccacatgcttgtggagcccaatctgtgccgctcagtcctcattgccaacacggtccggcagatccaagaggagatgacgcaggatgggacgtggcgcacagtggcaccccaggctgcagagcgggcgccgctcgaccgcttggtctccacggagatcctgtgccgtgcagcgtgggggcaagagggggcacatcctgctcctggcttgggggacggccacacacagggtccagtttctgacctttgcccagtcacctcagcacaggcaccaaggcacctgcagagcagcgcctgggagatggatggccctcgagaaaacagaggaagctttcacaagtcacttgatcagatatttgaaacgctggagactaaaaaccccagctgcatggaagagctgttctcagacgtggacagcccctactacgacctggacacagtactgacaggcatgatggggggtgccaggccgggcccctgcgaagggctcgagggcttggctccggccaccccaggccctagctccagctgcaagtccgacctgggcgagctggaccacgtggtggagatcctggtggagacctga
Sequence Length
726
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,114 Da
NCBI Official Full Name
Homo sapiens cell division cycle associated 4, mRNA
NCBI Official Synonym Full Names
cell division cycle associated 4
NCBI Official Symbol
CDCA4
NCBI Official Synonym Symbols
HEPP; SEI-3/HEPP
NCBI Protein Information
cell division cycle-associated protein 4
UniProt Protein Name
Cell division cycle-associated protein 4
UniProt Gene Name
CDCA4
UniProt Synonym Gene Names
HEPP
UniProt Entry Name
CDCA4_HUMAN

NCBI Description

This gene encodes a protein that belongs to the E2F family of transcription factors. This protein regulates E2F-dependent transcriptional activation and cell proliferation, mainly through the E2F/retinoblastoma protein pathway. It also functions in the regulation of JUN oncogene expression. This protein shows distinctive nuclear-mitotic apparatus distribution, it is involved in spindle organization from prometaphase, and may also play a role as a midzone factor involved in chromosome segregation or cytokinesis. Two alternatively spliced transcript variants encoding the same protein have been noted for this gene. Two pseudogenes have also been identified on chromosome 1. [provided by RefSeq, May 2014]

Uniprot Description

CDCA4: May participate in the regulation of cell proliferation through the E2F/RB pathway. May be involved in molecular regulation of hematopoietic stem cells and progenitor cell lineage commitment and differentiation.

Protein type: Transcription regulation

Chromosomal Location of Human Ortholog: 14q32.33

Molecular Function: protein binding

Research Articles on CDCA4

Similar Products

Product Notes

The CDCA4 cdca4 (Catalog #AAA1267696) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttgcac gaggactgaa gaggaaatgt gttggccacg aggaagacgt ggagggagcc ctggccggct tgaagacagt gtcctcatac agcctgcagc ggcagtcgct cctggacatg tctctggtga agttgcagct ttgccacatg cttgtggagc ccaatctgtg ccgctcagtc ctcattgcca acacggtccg gcagatccaa gaggagatga cgcaggatgg gacgtggcgc acagtggcac cccaggctgc agagcgggcg ccgctcgacc gcttggtctc cacggagatc ctgtgccgtg cagcgtgggg gcaagagggg gcacatcctg ctcctggctt gggggacggc cacacacagg gtccagtttc tgacctttgc ccagtcacct cagcacaggc accaaggcac ctgcagagca gcgcctggga gatggatggc cctcgagaaa acagaggaag ctttcacaag tcacttgatc agatatttga aacgctggag actaaaaacc ccagctgcat ggaagagctg ttctcagacg tggacagccc ctactacgac ctggacacag tactgacagg catgatgggg ggtgccaggc cgggcccctg cgaagggctc gagggcttgg ctccggccac cccaggccct agctccagct gcaagtccga cctgggcgag ctggaccacg tggtggagat cctggtggag acctga. It is sometimes possible for the material contained within the vial of "CDCA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.