Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC5L cdna clone

CDC5L cDNA Clone

Gene Names
CDC5L; CDC5; CEF1; PCDC5RP; CDC5-LIKE; dJ319D22.1
Synonyms
CDC5L; CDC5L cDNA Clone; CDC5L cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcgaattatgatcaaggggggcgtatggaggaataccgaggatgaaattctgaaagcagcggtaatgaaatatgggaaaaatcagtggtctaggattgcctcattgctgcatagaaaatcagcaaagcagtgcaaagccagatggtatgaatggctggatccaagcattaagaagacagaatggtccagagaagaagaggaaaaactcttgcacttggccaagttgatgccaactcagtggaggaccattgctccaatcattggaagaacagcggcccagtgcttagaacactatgaatttcttctggataaagctgcccaaagagacaatgaagaggaaacaacagatgatccacgaaaacttaaacctggagaaatagatccaaatccagaaacaaaaccagcgcggcctgatccaattgatatggatgaggatgaacttgagatgctttctgaagccagagcccgcttggctaatactcagggaaagaaggccaagaggaaagcaagagagaaacaattggaagaagcaagacgtcttgctgccctccaaaaaagaagagaacttcgagcagctggcatagaaattcagaagaaaagaaaaaggaagagaggagttgattataatgccgaaatcccatttgaaaaaaagcctgcccttggtttttatgatacttctgaggaaaactaccaagctcttgacgcagatttcaggaaattaagacaacaggatcttgatggggagctaagatctgaaaaagaaggaagagatagaaaaaaagacaaacagcatttgaaaaggaaaaaagaatctgatttaccatcagctattcttcaaactagtggtgtttctgaatttactaaaaagagaagcaaactagtacttcctgcccctcagatttcagatgcagaactccaggaagttgtaaaagtaggccaagcgagtgaaattgcacgtcaaactgccgaggaatctggcataacaaattctgcttccagtacacttttgtctgagtacaatgtcaccaacaacagcgttgctcttagaacaccacgaacaccagcttcccaggacagaattctgcaggaagcccagaacctcatggccctcaccaatgtggacaccccattgaaaggtggacttaataccccattgcatgagagtgacttctcaggtgtaactccacagcgacaagttgtacagactccaaacacagttctctctactccattcaggactccttctaatggagctgaagggctgactccccggagtggaacaactcccaaaccagttattaactctactccgggtagaactcctcttcgagacaagttaaacattaatcccgaggatggaatggcagactatagtgatccctcttacgtgaagcagatggaaagagaatcccgagaacatctccgtttagggttgttgggccttcctgcccctaagaatgattttgaaattgttctaccagaaaatgccgagaaggagctggaagaacgtgaaatagatgatacttacattgaagatgctgctgatgtggatgctcgaaagcaggccatacgagatgcagagcgtgtaaaggaaatgaaacgaatgcataaagctgtccagaaagatctgccaagaccatcagaagtaaatgaaactattctaagacccttaaatgtagaaccgcctttaacagatttacagaaaagtgaagaactaatcaaaaaagaaatgatcacaatgcttcattatgaccttctacatcacccttatgaaccatctggaaataaaaaaggcaaaactgtagggtttggtaccaataattcagagcacattacctatctggaacataatccttatgaaaagttctccaaagaagagctgaaaaaggcccaggatgttttggtgcaggagatggaagtggttaaacaaggaatgagccatggagagctctcaagtgaagcttataaccaggtgtgggaagaatgctacagtcaagttttatatcttcctgggcagagccgctacacacgggccaatctggctagtaaaaaggacagaattgaatcacttgaaaagaggctcgagataaacaggggtcacatgacgacagaagccaagagggctgcaaagatggaaaagaagatgaaaattttgcttgggggttaccagtctcgtgctatggggctcatgaaacagttgaatgacttatgggaccaaattgaacaggctcacttggagttacgcacttttgaagaactcaagaaacatgaagattctgctattccccggaggctagagtgtctaaaagaagacgttcagcgacaacaagaaagagaaaaggaacttcaacatagatatgctgatttgctgctggagaaagagactttaaagtcaaaattctga
Sequence Length
2409
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
988
Molecular Weight
92,251 Da
NCBI Official Full Name
Homo sapiens CDC5 cell division cycle 5-like (S. pombe), mRNA
NCBI Official Synonym Full Names
cell division cycle 5 like
NCBI Official Symbol
CDC5L
NCBI Official Synonym Symbols
CDC5; CEF1; PCDC5RP; CDC5-LIKE; dJ319D22.1
NCBI Protein Information
cell division cycle 5-like protein
UniProt Protein Name
Cell division cycle 5-like protein
UniProt Gene Name
CDC5L
UniProt Synonym Gene Names
KIAA0432; PCDC5RP; Cdc5-like protein
UniProt Entry Name
CDC5L_HUMAN

NCBI Description

The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]

Uniprot Description

CDC5L: is a spliceosome protein that binds DNA and that also regulates transcription. Is a positive regulator of cell cycle G2/M progression. Is an essential component of non-snRNA spliceosomes and is required for the second catalytic step of pre-mRNA splicing. Binds adeno-pre-mRNA in an ATP-stimulated manner. Is part of a spliceosomal 'core' complex that includes CDC5L, SF2, PRLI, SPF27, HSP7C, PRPF19/SNEV, GCN1L. Identified in the spliceosome C complex. Has been associated with aneuploidy in aging cells and in tumorigenesis. The genomic region containing the gene for CDC5L (6p21.1) is frequently amplified in osteosarcomas.

Protein type: Motility/polarity/chemotaxis; Spliceosome; DNA-binding; RNA splicing; Transcription factor; RNA processing

Chromosomal Location of Human Ortholog: 6p21

Cellular Component: cytoplasm; DNA replication factor A complex; membrane; nuclear speck; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; sequence-specific DNA binding

Biological Process: cell differentiation; nuclear mRNA splicing, via spliceosome; regulation of transcription from RNA polymerase II promoter

Research Articles on CDC5L

Similar Products

Product Notes

The CDC5L cdc5l (Catalog #AAA1272481) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcgaa ttatgatcaa ggggggcgta tggaggaata ccgaggatga aattctgaaa gcagcggtaa tgaaatatgg gaaaaatcag tggtctagga ttgcctcatt gctgcataga aaatcagcaa agcagtgcaa agccagatgg tatgaatggc tggatccaag cattaagaag acagaatggt ccagagaaga agaggaaaaa ctcttgcact tggccaagtt gatgccaact cagtggagga ccattgctcc aatcattgga agaacagcgg cccagtgctt agaacactat gaatttcttc tggataaagc tgcccaaaga gacaatgaag aggaaacaac agatgatcca cgaaaactta aacctggaga aatagatcca aatccagaaa caaaaccagc gcggcctgat ccaattgata tggatgagga tgaacttgag atgctttctg aagccagagc ccgcttggct aatactcagg gaaagaaggc caagaggaaa gcaagagaga aacaattgga agaagcaaga cgtcttgctg ccctccaaaa aagaagagaa cttcgagcag ctggcataga aattcagaag aaaagaaaaa ggaagagagg agttgattat aatgccgaaa tcccatttga aaaaaagcct gcccttggtt tttatgatac ttctgaggaa aactaccaag ctcttgacgc agatttcagg aaattaagac aacaggatct tgatggggag ctaagatctg aaaaagaagg aagagataga aaaaaagaca aacagcattt gaaaaggaaa aaagaatctg atttaccatc agctattctt caaactagtg gtgtttctga atttactaaa aagagaagca aactagtact tcctgcccct cagatttcag atgcagaact ccaggaagtt gtaaaagtag gccaagcgag tgaaattgca cgtcaaactg ccgaggaatc tggcataaca aattctgctt ccagtacact tttgtctgag tacaatgtca ccaacaacag cgttgctctt agaacaccac gaacaccagc ttcccaggac agaattctgc aggaagccca gaacctcatg gccctcacca atgtggacac cccattgaaa ggtggactta ataccccatt gcatgagagt gacttctcag gtgtaactcc acagcgacaa gttgtacaga ctccaaacac agttctctct actccattca ggactccttc taatggagct gaagggctga ctccccggag tggaacaact cccaaaccag ttattaactc tactccgggt agaactcctc ttcgagacaa gttaaacatt aatcccgagg atggaatggc agactatagt gatccctctt acgtgaagca gatggaaaga gaatcccgag aacatctccg tttagggttg ttgggccttc ctgcccctaa gaatgatttt gaaattgttc taccagaaaa tgccgagaag gagctggaag aacgtgaaat agatgatact tacattgaag atgctgctga tgtggatgct cgaaagcagg ccatacgaga tgcagagcgt gtaaaggaaa tgaaacgaat gcataaagct gtccagaaag atctgccaag accatcagaa gtaaatgaaa ctattctaag acccttaaat gtagaaccgc ctttaacaga tttacagaaa agtgaagaac taatcaaaaa agaaatgatc acaatgcttc attatgacct tctacatcac ccttatgaac catctggaaa taaaaaaggc aaaactgtag ggtttggtac caataattca gagcacatta cctatctgga acataatcct tatgaaaagt tctccaaaga agagctgaaa aaggcccagg atgttttggt gcaggagatg gaagtggtta aacaaggaat gagccatgga gagctctcaa gtgaagctta taaccaggtg tgggaagaat gctacagtca agttttatat cttcctgggc agagccgcta cacacgggcc aatctggcta gtaaaaagga cagaattgaa tcacttgaaa agaggctcga gataaacagg ggtcacatga cgacagaagc caagagggct gcaaagatgg aaaagaagat gaaaattttg cttgggggtt accagtctcg tgctatgggg ctcatgaaac agttgaatga cttatgggac caaattgaac aggctcactt ggagttacgc acttttgaag aactcaagaa acatgaagat tctgctattc cccggaggct agagtgtcta aaagaagacg ttcagcgaca acaagaaaga gaaaaggaac ttcaacatag atatgctgat ttgctgctgg agaaagagac tttaaagtca aaattctga. It is sometimes possible for the material contained within the vial of "CDC5L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.