Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC42SE2 cdna clone

CDC42SE2 cDNA Clone

Gene Names
CDC42SE2; SPEC2
Synonyms
CDC42SE2; CDC42SE2 cDNA Clone; CDC42SE2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAGTGAATTCTGGTTGTGTTTCAACTGCTGTATTGCAGAACAGCCTCAGCCTAAAAGGCGACGGCGGATTGACAGAAGTATGATTGGAGAGCCCACAAACTTTGTGCATACAGCTCATGTTGGATCAGGAGACCTGTTCAGTGGAATGAATTCAGTTAGCTCCATTCAGAACCAAATGCAGTCCAAGGGAGGTTATGGAGGTGGAATGCCTGCCAATGTCCAGATGCAGCTCGTGGATACGAAGGCGGGATAG
Sequence Length
255
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,223 Da
NCBI Official Full Name
Homo sapiens CDC42 small effector 2, mRNA
NCBI Official Synonym Full Names
CDC42 small effector 2
NCBI Official Symbol
CDC42SE2
NCBI Official Synonym Symbols
SPEC2
NCBI Protein Information
CDC42 small effector protein 2
UniProt Protein Name
CDC42 small effector protein 2
UniProt Gene Name
CDC42SE2
UniProt Synonym Gene Names
SPEC2
UniProt Entry Name
C42S2_HUMAN

Uniprot Description

CDC42SE2: Probably involved in the organization of the actin cytoskeleton by acting downstream of CDC42, inducing actin filament assembly. Alters CDC42-induced cell shape changes. In activated T-cells, may play a role in CDC42-mediated F-actin accumulation at the immunological synapse. May play a role in early contractile events in phagocytosis in macrophages. Belongs to the CDC42SE/SPEC family.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: plasma membrane

Molecular Function: protein binding; structural molecule activity

Biological Process: regulation of signal transduction

Research Articles on CDC42SE2

Similar Products

Product Notes

The CDC42SE2 cdc42se2 (Catalog #AAA1265826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGTGAAT TCTGGTTGTG TTTCAACTGC TGTATTGCAG AACAGCCTCA GCCTAAAAGG CGACGGCGGA TTGACAGAAG TATGATTGGA GAGCCCACAA ACTTTGTGCA TACAGCTCAT GTTGGATCAG GAGACCTGTT CAGTGGAATG AATTCAGTTA GCTCCATTCA GAACCAAATG CAGTCCAAGG GAGGTTATGG AGGTGGAATG CCTGCCAATG TCCAGATGCA GCTCGTGGAT ACGAAGGCGG GATAG. It is sometimes possible for the material contained within the vial of "CDC42SE2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.