Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC27 cdna clone

CDC27 cDNA Clone

Gene Names
CDC27; APC3; HNUC; NUC2; H-NUC; ANAPC3; CDC27Hs; D0S1430E; D17S978E
Synonyms
CDC27; CDC27 cDNA Clone; CDC27 cdna clone
Ordering
For Research Use Only!
Sequence
atgacggtgctgcaggaacccgtccaggctgctatatggcaagcactaaaccactatgcttaccgagatgcggttttcctcgcagaacgcctttatgcagaagtacactcagaagaagccttgtttttactggcaacctgttattaccgctcaggaaaggcatataaagcatatagactcttgaaaggacacagttgtactacaccgcaatgcaaatacctgcttgcaaaatgttgtgttgatctcagcaagcttgcagaaggggaacaaatcttatctggtggagtgtttaataagcagaaaagccatgatgatattgttactgagtttggtgattcagcttgctttactctttcattgttgggacatgtatattgcaagacagatcggcttgccaaaggatcagaatgttaccaaaagagccttagtttaaatcctttcctctggtctccctttgaatcattatgtgaaataggtgaaaagccagatcctgaccaaacatttaaattcacatctttacagaactttagcaactgtctgcccaactcttgcacaacacaagtacctaatcatagtttatctcacagacagcctgagacagttcttacggaaacaccccaggacacaattgaattaaacagattgaatttagaatcttccaattcaaagtactccttgaatacagattcctcagtgtcttatattgattcagctgtaatttcacctgatactgtcccactgggaacaggaacttccatattatctaaacaggttcaaaataaaccaaaaactggtcgaagtttattaggaggaccagcagctcttagtccattaaccccaagttttgggattttgccattagaaaccccaagtcctggagatggatcctatttacaaaactacactaatacacctcctgtaattgatgtgccatccaccggagccccttcaaaaaagacttttcgtgttttacagtctgttgccagaatcggccaaactggaacaaagtctgtcttctcacagagtggaaatagccgagaggtaactccaattcttgcacaaacacaaagttctggtccacaaacaagtacaacacctcaggtattgagccccactattacatctcccccaaacgcactgcctcgaagaagttcacgactctttactagtgacagctccacaaccaaggagaatagcaaaaaattaaaaatgaagtttccacctgaaatcccaaacagaaaaacaaaaagtaaaactaataaaggaggaataactcaacctaacataaatgatagcctggaaattacaaaattggactcttccatcatttcagaagggaaaatatccacaatcacacctcagattcaggcctttaatctacaaaaagcagcagcagaaggtttgatgagccttcttcgtgaaatggggaaaggttatttagctttgtgttcatacaactgcaaagaagctataaatattttgagccatctaccttctcaccactacaatactggttgggtactgtgccaaattggaagggcctattttgaactttcagagtacatgcaagctgaaagaatattctcagaggttagaaggattgagaattatagagttgaaggcatggagatctactctacaacactttggcatcttcaaaaagatgttgctctttcagttctgtcaaaagacttaacagacatggataaaaattcgccagaggcctggtgtgctgcagggaactgtttcagtctgcaacgggaacatgatattgcaattaaattcttccagagagctatccaagttgatccaaattacgcttatgcctatactctattagggcatgagtttgtcttaactgaagaattggacaaagcattagcttgttttcgaaatgctatcagagtcaatcctagacattataatgcatggtatggtttaggaatgatttattacaagcaagaaaaattcagccttgcagaaatgcatttccaaaaagcgcttgatatcaaccctcaaagttcagttttactttgccacattggagtagttcaacatgcactgaaaaaatcagagaaggctttggataccctaaacaaagccattgtcattgatcccaagaaccctctatgcaaatttcacagagcctcagttttatttgcaaatgaaaaatataagtctgctttacaagaacttgaagaattgaaacaaattgttcccaaagaatccctcgtttacttcttaataggaaaggtttacaagaagttaggtcaaacgcacctcgccctgatgaatttctcttgggctatggatttagatcctaaaggagccaataaccagattaaagaggcaattgataagcgttatcttccagatgatgaggagccaataacccaagaagaacagatcatgggaacagatgaatcccaggagagcagcatgacagatgcggatgacacacaacttcatgcagctgaaagtgatgaattttaa
Sequence Length
2493
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
996
Molecular Weight
92,612 Da
NCBI Official Full Name
Homo sapiens cell division cycle 27 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 27
NCBI Official Symbol
CDC27
NCBI Official Synonym Symbols
APC3; HNUC; NUC2; H-NUC; ANAPC3; CDC27Hs; D0S1430E; D17S978E
NCBI Protein Information
cell division cycle protein 27 homolog
UniProt Protein Name
Cell division cycle protein 27 homolog
UniProt Gene Name
CDC27
UniProt Synonym Gene Names
ANAPC3; D0S1430E; D17S978E; APC3; CDC27Hs
UniProt Entry Name
CDC27_HUMAN

NCBI Description

The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]

Uniprot Description

CDC27: Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. The APC/C is composed of at least 12 subunits. Interacts with RB. Interacts with FAM168B/MANI. Belongs to the APC3/CDC27 family.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 17q21.32

Cellular Component: anaphase-promoting complex; centrosome; cytoplasm; cytosol; nucleoplasm; nucleus; spindle; spindle microtubule

Molecular Function: protein binding; protein phosphatase binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; cell proliferation; mitotic metaphase/anaphase transition; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of ubiquitin-protein ligase activity during mitotic cell cycle

Research Articles on CDC27

Similar Products

Product Notes

The CDC27 cdc27 (Catalog #AAA1268703) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggtgc tgcaggaacc cgtccaggct gctatatggc aagcactaaa ccactatgct taccgagatg cggttttcct cgcagaacgc ctttatgcag aagtacactc agaagaagcc ttgtttttac tggcaacctg ttattaccgc tcaggaaagg catataaagc atatagactc ttgaaaggac acagttgtac tacaccgcaa tgcaaatacc tgcttgcaaa atgttgtgtt gatctcagca agcttgcaga aggggaacaa atcttatctg gtggagtgtt taataagcag aaaagccatg atgatattgt tactgagttt ggtgattcag cttgctttac tctttcattg ttgggacatg tatattgcaa gacagatcgg cttgccaaag gatcagaatg ttaccaaaag agccttagtt taaatccttt cctctggtct ccctttgaat cattatgtga aataggtgaa aagccagatc ctgaccaaac atttaaattc acatctttac agaactttag caactgtctg cccaactctt gcacaacaca agtacctaat catagtttat ctcacagaca gcctgagaca gttcttacgg aaacacccca ggacacaatt gaattaaaca gattgaattt agaatcttcc aattcaaagt actccttgaa tacagattcc tcagtgtctt atattgattc agctgtaatt tcacctgata ctgtcccact gggaacagga acttccatat tatctaaaca ggttcaaaat aaaccaaaaa ctggtcgaag tttattagga ggaccagcag ctcttagtcc attaacccca agttttggga ttttgccatt agaaacccca agtcctggag atggatccta tttacaaaac tacactaata cacctcctgt aattgatgtg ccatccaccg gagccccttc aaaaaagact tttcgtgttt tacagtctgt tgccagaatc ggccaaactg gaacaaagtc tgtcttctca cagagtggaa atagccgaga ggtaactcca attcttgcac aaacacaaag ttctggtcca caaacaagta caacacctca ggtattgagc cccactatta catctccccc aaacgcactg cctcgaagaa gttcacgact ctttactagt gacagctcca caaccaagga gaatagcaaa aaattaaaaa tgaagtttcc acctgaaatc ccaaacagaa aaacaaaaag taaaactaat aaaggaggaa taactcaacc taacataaat gatagcctgg aaattacaaa attggactct tccatcattt cagaagggaa aatatccaca atcacacctc agattcaggc ctttaatcta caaaaagcag cagcagaagg tttgatgagc cttcttcgtg aaatggggaa aggttattta gctttgtgtt catacaactg caaagaagct ataaatattt tgagccatct accttctcac cactacaata ctggttgggt actgtgccaa attggaaggg cctattttga actttcagag tacatgcaag ctgaaagaat attctcagag gttagaagga ttgagaatta tagagttgaa ggcatggaga tctactctac aacactttgg catcttcaaa aagatgttgc tctttcagtt ctgtcaaaag acttaacaga catggataaa aattcgccag aggcctggtg tgctgcaggg aactgtttca gtctgcaacg ggaacatgat attgcaatta aattcttcca gagagctatc caagttgatc caaattacgc ttatgcctat actctattag ggcatgagtt tgtcttaact gaagaattgg acaaagcatt agcttgtttt cgaaatgcta tcagagtcaa tcctagacat tataatgcat ggtatggttt aggaatgatt tattacaagc aagaaaaatt cagccttgca gaaatgcatt tccaaaaagc gcttgatatc aaccctcaaa gttcagtttt actttgccac attggagtag ttcaacatgc actgaaaaaa tcagagaagg ctttggatac cctaaacaaa gccattgtca ttgatcccaa gaaccctcta tgcaaatttc acagagcctc agttttattt gcaaatgaaa aatataagtc tgctttacaa gaacttgaag aattgaaaca aattgttccc aaagaatccc tcgtttactt cttaatagga aaggtttaca agaagttagg tcaaacgcac ctcgccctga tgaatttctc ttgggctatg gatttagatc ctaaaggagc caataaccag attaaagagg caattgataa gcgttatctt ccagatgatg aggagccaat aacccaagaa gaacagatca tgggaacaga tgaatcccag gagagcagca tgacagatgc ggatgacaca caacttcatg cagctgaaag tgatgaattt taa. It is sometimes possible for the material contained within the vial of "CDC27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.