CDC20B cdna clone
CDC20B cDNA Clone
Gene Names
CDC20B; G6VTS76519
Synonyms
CDC20B; CDC20B cDNA Clone; CDC20B cdna clone
Sequence
atggagtggaaactggagcgcaccgcgcctcggagggtccgcacggaagaggagatgctgtgggtactcgattcagttaatgctacgtattctgactttaagagcaactttgcgaagaggctgtccgcagaggttcctgttgcgagtagccccattaccacaaggtggcagcaaagtcaaactagggctctgtcctctgattcctttggggaagagcagtcaaccacctacctcccagaagcttccggatcagtgctgaagacaccgcctgagaaagagaccttgactctaggatcctgcaaagaacaactgaagacccccagcaaaggaatttctgaaacaagtaactctgctctccatttttgcaaggcacctcatgcaatggacagagactggaaagaaagtgttgcctcaaaagggcagaaatgcctaaaacaactctttgtaacccagaacgtggttcagcaggctaatggaaaaatgcagctctgtgagcaatccgaatgtgtttggaaagatcactttagtggcagcatgaagaaacgatttgaacaggaggatgttggtggcaaagactaa
Sequence Length
579
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,697 Da
NCBI Official Full Name
Homo sapiens cell division cycle 20 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 20B
NCBI Official Symbol
CDC20B
NCBI Official Synonym Symbols
G6VTS76519
NCBI Protein Information
cell division cycle protein 20 homolog B
UniProt Protein Name
Cell division cycle protein 20 homolog B
Protein Family
UniProt Gene Name
CDC20B
UniProt Entry Name
CD20B_HUMAN
Uniprot Description
CDC20B: Belongs to the WD repeat CDC20/Fizzy family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 5q11.2
Molecular Function: protein binding
Similar Products
Product Notes
The CDC20B cdc20b (Catalog #AAA1267453) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtgga aactggagcg caccgcgcct cggagggtcc gcacggaaga ggagatgctg tgggtactcg attcagttaa tgctacgtat tctgacttta agagcaactt tgcgaagagg ctgtccgcag aggttcctgt tgcgagtagc cccattacca caaggtggca gcaaagtcaa actagggctc tgtcctctga ttcctttggg gaagagcagt caaccaccta cctcccagaa gcttccggat cagtgctgaa gacaccgcct gagaaagaga ccttgactct aggatcctgc aaagaacaac tgaagacccc cagcaaagga atttctgaaa caagtaactc tgctctccat ttttgcaagg cacctcatgc aatggacaga gactggaaag aaagtgttgc ctcaaaaggg cagaaatgcc taaaacaact ctttgtaacc cagaacgtgg ttcagcaggc taatggaaaa atgcagctct gtgagcaatc cgaatgtgtt tggaaagatc actttagtgg cagcatgaag aaacgatttg aacaggagga tgttggtggc aaagactaa. It is sometimes possible for the material contained within the vial of "CDC20B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
