Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC16 cdna clone

CDC16 cDNA Clone

Gene Names
CDC16; APC6; CUT9; ANAPC6; CDC16Hs
Synonyms
CDC16; CDC16 cDNA Clone; CDC16 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacctagagcggctgcggaagcgcgtccggcagtacctcgaccagcaacagtatcaaagtgctctattttgggcagataaagtagcttcactctctcgtgaagaaccccaggacatctattggttggctcaatgtctttacctgacagcacaatatcacagagccgcccatgcacttcggtcacgaaaactggacaaattgtatgaagcatgtcgttaccttgcagctaggtgccattatgctgcaaaagagcaccagcaggcccttgatgttcttgacatggaagagcccatcaataaaagattatttgaaaaatacttgaaggatgaaagtggcttcaaagatccctccagcgactgggaaatgtcacagtcttcaataaagagttctatctgtcttctacgcgggaaaatctatgatgctctagataaccgaaccctggctacctacagctacaaagaagctttgaagcttgatgtctactgttttgaagcgttcgatcttttaacatcacatcacatgctgacagcacaagaagaaaaagaacttcttgaatcactaccccttagcaagctgtgtaatgaagaacaggaattgctgcgttttctatttgagaacaaattgaaaaaatataataagcctagtgaaacggtcatccctgaatctgtagatggcttgcaagagaatctggatgtggtagtgtctttagctgagagacattattataactgtgattttaaaatgtgctacaagcttacttctgtagtaatggagaaagatcctttccatgcaagttgtttacctgtacatatagggacgcttgtagagctgaataaagccaatgaacttttctatctttctcataaactggtggatttatatcctagtaatcctgtgtcttggtttgcagtgggatgttactatctcatggtcggtcataaaaatgaacatgccagaagatatctcagcaaagccacaacacttgagaaaacctatggacctgcatggatagcctatggacattcatttgcggtggagagtgagcacgaccaagcgatggctgcttacttcacagcagcacagctgatgaaagggtgtcatttgcctatgctgtatattggattagaatatggtttgaccaataactcaaaactagctgaaaggttcttcagccaagctctgagcattgcaccggaagacccttttgttatgcatgaggtcggcgtggttgcatttcagaatggagaatggaaaacagccgaaaaatggtttcttgatgctttggaaaaaattaaagcaattgggaacgaggtaacagttgacaaatgggaacctttgttgaacaacttggggcatgtctgcagaaaacttaaaaagtatgctgaggccttggattaccaccgtcaggcactggtgttgattcctcagaacgcatccacctactctgctattggatatatccacagtctgatgggcaactttgaaaatgctgtggactacttccacacagcccttggtcttaggcgagatgatacattttctgttacaatgcttggtcattgcatcgaaatgtacattggtgattctgaagcttatatcggagcagacattaaagacaaattaaaatgttatgactttgatgtgcatacaatgaagacactaaaaaacattatttcacctccgtgggatttcagggaatttgaagtagaaaaacagactgcagaagaaacggggcttacgccattggaaacctcaaggaaaactccagattccagaccttccttggaagaaacctttgaaattgaaatgaatgaaagtgacatgatgttagagacatctatgtcagaccacagcacgtga
Sequence Length
1863
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,371 Da
NCBI Official Full Name
Homo sapiens cell division cycle 16 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 16
NCBI Official Symbol
CDC16
NCBI Official Synonym Symbols
APC6; CUT9; ANAPC6; CDC16Hs
NCBI Protein Information
cell division cycle protein 16 homolog
UniProt Protein Name
Cell division cycle protein 16 homolog
UniProt Gene Name
CDC16
UniProt Synonym Gene Names
ANAPC6; APC6; CDC16Hs
UniProt Entry Name
CDC16_HUMAN

NCBI Description

The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]

Uniprot Description

CDC16: Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. The APC/C is composed of at least 12 subunits. Interacts with PPP5C and CDC20. Belongs to the APC6/CDC16 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 13q34

Cellular Component: anaphase-promoting complex; centrosome; cytoplasm; cytosol; nucleoplasm; spindle; spindle microtubule

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; cell proliferation; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of mitosis; regulation of ubiquitin-protein ligase activity during mitotic cell cycle

Research Articles on CDC16

Similar Products

Product Notes

The CDC16 cdc16 (Catalog #AAA1270455) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacctag agcggctgcg gaagcgcgtc cggcagtacc tcgaccagca acagtatcaa agtgctctat tttgggcaga taaagtagct tcactctctc gtgaagaacc ccaggacatc tattggttgg ctcaatgtct ttacctgaca gcacaatatc acagagccgc ccatgcactt cggtcacgaa aactggacaa attgtatgaa gcatgtcgtt accttgcagc taggtgccat tatgctgcaa aagagcacca gcaggccctt gatgttcttg acatggaaga gcccatcaat aaaagattat ttgaaaaata cttgaaggat gaaagtggct tcaaagatcc ctccagcgac tgggaaatgt cacagtcttc aataaagagt tctatctgtc ttctacgcgg gaaaatctat gatgctctag ataaccgaac cctggctacc tacagctaca aagaagcttt gaagcttgat gtctactgtt ttgaagcgtt cgatctttta acatcacatc acatgctgac agcacaagaa gaaaaagaac ttcttgaatc actacccctt agcaagctgt gtaatgaaga acaggaattg ctgcgttttc tatttgagaa caaattgaaa aaatataata agcctagtga aacggtcatc cctgaatctg tagatggctt gcaagagaat ctggatgtgg tagtgtcttt agctgagaga cattattata actgtgattt taaaatgtgc tacaagctta cttctgtagt aatggagaaa gatcctttcc atgcaagttg tttacctgta catataggga cgcttgtaga gctgaataaa gccaatgaac ttttctatct ttctcataaa ctggtggatt tatatcctag taatcctgtg tcttggtttg cagtgggatg ttactatctc atggtcggtc ataaaaatga acatgccaga agatatctca gcaaagccac aacacttgag aaaacctatg gacctgcatg gatagcctat ggacattcat ttgcggtgga gagtgagcac gaccaagcga tggctgctta cttcacagca gcacagctga tgaaagggtg tcatttgcct atgctgtata ttggattaga atatggtttg accaataact caaaactagc tgaaaggttc ttcagccaag ctctgagcat tgcaccggaa gacccttttg ttatgcatga ggtcggcgtg gttgcatttc agaatggaga atggaaaaca gccgaaaaat ggtttcttga tgctttggaa aaaattaaag caattgggaa cgaggtaaca gttgacaaat gggaaccttt gttgaacaac ttggggcatg tctgcagaaa acttaaaaag tatgctgagg ccttggatta ccaccgtcag gcactggtgt tgattcctca gaacgcatcc acctactctg ctattggata tatccacagt ctgatgggca actttgaaaa tgctgtggac tacttccaca cagcccttgg tcttaggcga gatgatacat tttctgttac aatgcttggt cattgcatcg aaatgtacat tggtgattct gaagcttata tcggagcaga cattaaagac aaattaaaat gttatgactt tgatgtgcat acaatgaaga cactaaaaaa cattatttca cctccgtggg atttcaggga atttgaagta gaaaaacaga ctgcagaaga aacggggctt acgccattgg aaacctcaag gaaaactcca gattccagac cttccttgga agaaaccttt gaaattgaaa tgaatgaaag tgacatgatg ttagagacat ctatgtcaga ccacagcacg tga. It is sometimes possible for the material contained within the vial of "CDC16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.