Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD79A cdna clone

CD79A cDNA Clone

Gene Names
CD79A; IGA; MB-1
Synonyms
CD79A; CD79A cDNA Clone; CD79A cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgggggtccaggagtcctccaagctctgcctgccaccatcttcctcctcttcctgctgtctgctgtctacctgggccctgggtgccaggccctgtggatgcacaaggtcccagcatcattgatggtgagcctgggggaagacgcccacttccaatgcccgcacaatagcagcaacaacgccaacgtcacctggtggcgcgtcctccatggcaactacacgtggccccctgagttcttgggcccgggcgaggaccccaatggtacgctgatcatccagaatgtgaacaagagccatgggggcatatacgtgtgccgggtccaggagggcaacgagtcataccagcagtcctgcggcacctacctccgcgtgcgccagccgccccccaggcccttcctggacatgggggagggcaccaagaaccgaatcatcacagccgaggggatcatcctcctgttctgcgcggtggtgcctgggacgctgctgctgttcaggaaacgatggcagaacgagaagctcgggttggatgccggggatgaatatgaagatgaaaacctttatgaaggcctgaacctggacgactgctccatgtatgaggacatctcccggggcctccagggcacctaccaggatgtgggcagcctcaacataggagatgtccagctggagaagccgtga
Sequence Length
681
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
973
Molecular Weight
20,786 Da
NCBI Official Full Name
Homo sapiens CD79a molecule, immunoglobulin-associated alpha, mRNA
NCBI Official Synonym Full Names
CD79a molecule
NCBI Official Symbol
CD79A
NCBI Official Synonym Symbols
IGA; MB-1
NCBI Protein Information
B-cell antigen receptor complex-associated protein alpha chain
UniProt Protein Name
B-cell antigen receptor complex-associated protein alpha chain
UniProt Gene Name
CD79A
UniProt Synonym Gene Names
IGA; MB1
UniProt Entry Name
CD79A_HUMAN

NCBI Description

The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

Ig-alpha: an integral membrane protein that associates with surface immunoglobulin B lymphocyte antigen receptor multimeric complex. Surface Ig non-covalently associates with 2 other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. Two alternatively spliced isoforms have been described.

Protein type: Membrane protein, integral; Immunoglobulin superfamily

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: B cell receptor complex; cytoplasm; external side of plasma membrane; integral to plasma membrane; lipid raft; multivesicular body; plasma membrane

Molecular Function: protein binding

Biological Process: B cell activation; B cell differentiation; B cell proliferation; B cell receptor signaling pathway

Disease: Agammaglobulinemia 3, Autosomal Recessive

Research Articles on CD79A

Similar Products

Product Notes

The CD79A cd79a (Catalog #AAA1270496) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgggg gtccaggagt cctccaagct ctgcctgcca ccatcttcct cctcttcctg ctgtctgctg tctacctggg ccctgggtgc caggccctgt ggatgcacaa ggtcccagca tcattgatgg tgagcctggg ggaagacgcc cacttccaat gcccgcacaa tagcagcaac aacgccaacg tcacctggtg gcgcgtcctc catggcaact acacgtggcc ccctgagttc ttgggcccgg gcgaggaccc caatggtacg ctgatcatcc agaatgtgaa caagagccat gggggcatat acgtgtgccg ggtccaggag ggcaacgagt cataccagca gtcctgcggc acctacctcc gcgtgcgcca gccgcccccc aggcccttcc tggacatggg ggagggcacc aagaaccgaa tcatcacagc cgaggggatc atcctcctgt tctgcgcggt ggtgcctggg acgctgctgc tgttcaggaa acgatggcag aacgagaagc tcgggttgga tgccggggat gaatatgaag atgaaaacct ttatgaaggc ctgaacctgg acgactgctc catgtatgag gacatctccc ggggcctcca gggcacctac caggatgtgg gcagcctcaa cataggagat gtccagctgg agaagccgtg a. It is sometimes possible for the material contained within the vial of "CD79A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.