Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD74 cdna clone

CD74 cDNA Clone

Gene Names
CD74; II; DHLAG; HLADG; Ia-GAMMA
Synonyms
CD74; CD74 cDNA Clone; CD74 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacaggaggagaagcaggagctgtcgggaagatcagaagccagtcatggatgaccagcgcgaccttatctccaacaatgagcaactgcccatgctgggccggcgccctggggccccggagagcaagtgcagccgcggagccctgtacacaggcttttccatcctggtgactctgctcctcgctggccaggccaccaccgcctacttcctgtaccagcagcagggccggctggacaaactgacagtcacctcccagaacctgcagctggagaacctgcgcatgaagcttcccaagcctcccaagcctgtgagcaagatgcgcatggccaccccgctgctgatgcaggcgctgcccatgggagccctgccccaggggcccatgcagaatgccaccaagtatggcaacatgacagaggaccatgtgatgcacctgctccagaatgctgaccccctgaaggtgtacccgccactgaaggggagcttcccggagaacctgagacaccttaagaacaccatggagaccatagactggaaggtctttgagagctggatgcaccattggctcctgtttgaaatgagcaggcactccttggagcaaaagcccactgacgctccaccgaaagagtcactggaactggaggacccgtcttctgggctgggtgtgaccaagcaggatctgggcccagtccccatgtga
Sequence Length
699
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
972
Molecular Weight
18,328 Da
NCBI Official Full Name
Homo sapiens CD74 molecule, major histocompatibility complex, class II invariant chain, mRNA
NCBI Official Synonym Full Names
CD74 molecule
NCBI Official Symbol
CD74
NCBI Official Synonym Symbols
II; DHLAG; HLADG; Ia-GAMMA
NCBI Protein Information
HLA class II histocompatibility antigen gamma chain
UniProt Protein Name
HLA class II histocompatibility antigen gamma chain
UniProt Gene Name
CD74
UniProt Synonym Gene Names
DHLAG; Ii
UniProt Entry Name
HG2A_HUMAN

NCBI Description

The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]

Uniprot Description

CD74: Plays a critical role in MHC class II antigen processing by stabilizing peptide-free class II alpha/beta heterodimers in a complex soon after their synthesis and directing transport of the complex from the endoplasmic reticulum to the endosomal/lysosomal system where the antigen processing and binding of antigenic peptides to MHC class II takes place. Serves as cell surface receptor for the cytokine MIF. A chromosomal aberration involving CD74 is found in a non-small cell lung tumor. Results in the formation of a CD74- ROS1 chimeric protein. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Endoplasmic reticulum; Membrane protein, integral; Receptor, cytokine

Chromosomal Location of Human Ortholog: 5q32

Cellular Component: cell surface; Golgi membrane; integral to membrane; intracellular; lysosomal lumen; lysosomal membrane; membrane; MHC class II protein complex; plasma membrane; trans-Golgi network membrane; vacuole

Molecular Function: beta-amyloid binding; cytokine binding; hematopoietin/interferon-class (D200-domain) cytokine receptor activity; identical protein binding; MHC class II protein binding; MHC class II protein binding, via antigen binding groove; protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; cell proliferation; immunoglobulin mediated immune response; intracellular protein transport; leukocyte migration; negative regulation of apoptosis; negative regulation of DNA damage response, signal transduction by p53 class mediator; negative regulation of peptide secretion; positive regulation of B cell proliferation; positive regulation of cytokine and chemokine mediated signaling pathway; positive regulation of fibroblast proliferation; positive regulation of peptidyl-tyrosine phosphorylation; prostaglandin biosynthetic process; protein complex assembly; signal transduction

Research Articles on CD74

Similar Products

Product Notes

The CD74 cd74 (Catalog #AAA7046715) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacagga ggagaagcag gagctgtcgg gaagatcaga agccagtcat ggatgaccag cgcgacctta tctccaacaa tgagcaactg cccatgctgg gccggcgccc tggggccccg gagagcaagt gcagccgcgg agccctgtac acaggctttt ccatcctggt gactctgctc ctcgctggcc aggccaccac cgcctacttc ctgtaccagc agcagggccg gctggacaaa ctgacagtca cctcccagaa cctgcagctg gagaacctgc gcatgaagct tcccaagcct cccaagcctg tgagcaagat gcgcatggcc accccgctgc tgatgcaggc gctgcccatg ggagccctgc cccaggggcc catgcagaat gccaccaagt atggcaacat gacagaggac catgtgatgc acctgctcca gaatgctgac cccctgaagg tgtacccgcc actgaagggg agcttcccgg agaacctgag acaccttaag aacaccatgg agaccataga ctggaaggtc tttgagagct ggatgcacca ttggctcctg tttgaaatga gcaggcactc cttggagcaa aagcccactg acgctccacc gaaagagtca ctggaactgg aggacccgtc ttctgggctg ggtgtgacca agcaggatct gggcccagtc cccatgtga. It is sometimes possible for the material contained within the vial of "CD74, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.