Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD7 cdna clone

CD7 cDNA Clone

Gene Names
CD7; GP40; TP41; Tp40; LEU-9
Synonyms
CD7; CD7 cDNA Clone; CD7 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgggcctccgaggctcctgctgctgcccctgcttctggcgctggctcgcggcctgcctggggccctggctgcccaagaggtgcagcagtctccccactgcacgactgtccccgtgggagcctccgtcaacatcacctgctccaccagcgggggcctgcgtgggatctacctgaggcagctcgggccacagccccaagacatcatttactacgaggacggggtggtgcccactacggacagacggttccggggccgcatcgacttctcagggtcccaggacaacctgactatcaccatgcaccgcctgcagctgtcggacactggcacctacacctgccaggccatcacggaggtcaatgtctacggctccggcaccctggtcctggtgacagaggaacagtcccaaggatggcacagatgctcggacgccccaccaagggcctctgccctccctgccccaccgacaggctccgccctccctgacccgcagacagcctctgccctccctgacccgccagcagcctctgccctccctgcggccctggcggtgatctccttcctcctcgggctgggcctgggggtggcgtgtgtgctggcgaggacacagataaagaaactgtgctcgtggcgggataagaattcggcggcatgtgtggtgtacgaggacatgtcgcacagccgctgcaacacgctgtcctcccccaaccagtaccagtga
Sequence Length
723
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
924
Molecular Weight
25,409 Da
NCBI Official Full Name
Homo sapiens CD7 molecule, mRNA
NCBI Official Synonym Full Names
CD7 molecule
NCBI Official Symbol
CD7
NCBI Official Synonym Symbols
GP40; TP41; Tp40; LEU-9
NCBI Protein Information
T-cell antigen CD7
UniProt Protein Name
T-cell antigen CD7
Protein Family
UniProt Gene Name
CD7
UniProt Entry Name
CD7_HUMAN

NCBI Description

This gene encodes a transmembrane protein which is a member of the immunoglobulin superfamily. This protein is found on thymocytes and mature T cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development. [provided by RefSeq, Jul 2008]

Uniprot Description

CD7: Not yet known.

Protein type: Immunoglobulin superfamily; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17q25.2-q25.3

Cellular Component: integral to membrane; membrane; plasma membrane

Molecular Function: receptor activity

Biological Process: immune response; T cell activation

Research Articles on CD7

Similar Products

Product Notes

The CD7 cd7 (Catalog #AAA1271188) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgggc ctccgaggct cctgctgctg cccctgcttc tggcgctggc tcgcggcctg cctggggccc tggctgccca agaggtgcag cagtctcccc actgcacgac tgtccccgtg ggagcctccg tcaacatcac ctgctccacc agcgggggcc tgcgtgggat ctacctgagg cagctcgggc cacagcccca agacatcatt tactacgagg acggggtggt gcccactacg gacagacggt tccggggccg catcgacttc tcagggtccc aggacaacct gactatcacc atgcaccgcc tgcagctgtc ggacactggc acctacacct gccaggccat cacggaggtc aatgtctacg gctccggcac cctggtcctg gtgacagagg aacagtccca aggatggcac agatgctcgg acgccccacc aagggcctct gccctccctg ccccaccgac aggctccgcc ctccctgacc cgcagacagc ctctgccctc cctgacccgc cagcagcctc tgccctccct gcggccctgg cggtgatctc cttcctcctc gggctgggcc tgggggtggc gtgtgtgctg gcgaggacac agataaagaa actgtgctcg tggcgggata agaattcggc ggcatgtgtg gtgtacgagg acatgtcgca cagccgctgc aacacgctgt cctcccccaa ccagtaccag tga. It is sometimes possible for the material contained within the vial of "CD7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.