Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD55 cdna clone

CD55 cDNA Clone

Gene Names
CD55; CR; TC; DAF; CROM
Synonyms
CD55; CD55 cDNA Clone; CD55 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgtcgcgcggccgagcgtgcccgcggcgctgcccctcctcggggagctgccccggctgctgctgctggtgctgttgtgcctgccggccgtgtggggtgactgtggccttcccccagatgtacctaatgcccagccagctttggaaggccgtacaagttttcccgaggatactgtaataacgtacaaatgtgaagaaagctttgtgaaaattcctggcgagaaggactcagtgatctgccttaagggcagtcaatggtcagatattgaagagttctgcaatcgtagctgcgaggtgccaacaaggctaaattctgcatccctcaaacagccttatatcactcagaattattttccagtcggtactgttgtggaatatgagtgccgtccaggttacagaagagaaccttctctatcaccaaaactaacttgccttcagaatttaaaatggtccacagcagtcgaattttgtaaaaagaaatcatgccctaatccgggagaaatacgaaatggtcagattgatgtaccaggtggcatattatttggtgcaaccatctccttctcatgtaacacagggtacaaattatttggctcgacttctagtttttgtcttatttcaggcagctctgtccagtggagtgacccgttgccagagtgcagagaaatttattgtccagcaccaccacaaattgacaatggaataattcaaggggaacgtgaccattatggatatagacagtctgtaacgtatgcatgtaataaaggattcaccatgattggagagcactctatttattgtactgtgaataatgatgaaggagagtggagtggcccaccacctgaatgcagaggaaaatctctaacttccaaggtcccaccaacagttcagaaacctaccacagtaaatgttccaactacagaagtctcaccaacttctcagaaaaccaccacaaaaaccaccacaccaaatgctcaagcaacacggagtacacctgtttccaggacaaccaagcattttcatgaaacaaccccaaataaaggaagtggaaccacttcaggtactacccgtcttctatctgggcacacgtgtttcacgttgacaggtttgcttgggacgctagtaaccatgggcttgctgacttag
Sequence Length
1146
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,038 Da
NCBI Official Full Name
Homo sapiens CD55 molecule, decay accelerating factor for complement (Cromer blood group), mRNA
NCBI Official Synonym Full Names
CD55 molecule (Cromer blood group)
NCBI Official Symbol
CD55
NCBI Official Synonym Symbols
CR; TC; DAF; CROM
NCBI Protein Information
complement decay-accelerating factor
UniProt Protein Name
Complement decay-accelerating factor
UniProt Gene Name
CD55
UniProt Synonym Gene Names
CR; DAF
UniProt Entry Name
DAF_HUMAN

NCBI Description

This gene encodes a glycoprotein involved in the regulation of the complement cascade. Binding of the encoded protein to complement proteins accelerates their decay, thereby disrupting the cascade and preventing damage to host cells. Antigens present on this protein constitute the Cromer blood group system (CROM). Alternative splicing results in multiple transcript variants. The predominant transcript variant encodes a membrane-bound protein, but alternatively spliced transcripts may produce soluble proteins. [provided by RefSeq, Jul 2014]

Uniprot Description

CD55: This protein recognizes C4b and C3b fragments that condense with cell-surface hydroxyl or amino groups when nascent C4b and C3b are locally generated during C4 and c3 activation. Interaction of daf with cell-associated C4b and C3b polypeptides interferes with their ability to catalyze the conversion of C2 and factor B to enzymatically active C2a and Bb and thereby prevents the formation of C4b2a and C3bBb, the amplification convertases of the complement cascade. Belongs to the receptors of complement activation (RCA) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell surface; Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: cell surface; ER-Golgi intermediate compartment membrane; extracellular region; Golgi membrane; integral to plasma membrane; lipid raft; plasma membrane; transport vesicle

Molecular Function: lipid binding; protein binding; viral receptor activity

Biological Process: elevation of cytosolic calcium ion concentration; ER to Golgi vesicle-mediated transport; negative regulation of complement activation; regulation of complement activation; regulation of lipopolysaccharide-mediated signaling pathway

Disease: Blood Group, Cromer System

Research Articles on CD55

Similar Products

Product Notes

The CD55 cd55 (Catalog #AAA1267012) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgtcg cgcggccgag cgtgcccgcg gcgctgcccc tcctcgggga gctgccccgg ctgctgctgc tggtgctgtt gtgcctgccg gccgtgtggg gtgactgtgg ccttccccca gatgtaccta atgcccagcc agctttggaa ggccgtacaa gttttcccga ggatactgta ataacgtaca aatgtgaaga aagctttgtg aaaattcctg gcgagaagga ctcagtgatc tgccttaagg gcagtcaatg gtcagatatt gaagagttct gcaatcgtag ctgcgaggtg ccaacaaggc taaattctgc atccctcaaa cagccttata tcactcagaa ttattttcca gtcggtactg ttgtggaata tgagtgccgt ccaggttaca gaagagaacc ttctctatca ccaaaactaa cttgccttca gaatttaaaa tggtccacag cagtcgaatt ttgtaaaaag aaatcatgcc ctaatccggg agaaatacga aatggtcaga ttgatgtacc aggtggcata ttatttggtg caaccatctc cttctcatgt aacacagggt acaaattatt tggctcgact tctagttttt gtcttatttc aggcagctct gtccagtgga gtgacccgtt gccagagtgc agagaaattt attgtccagc accaccacaa attgacaatg gaataattca aggggaacgt gaccattatg gatatagaca gtctgtaacg tatgcatgta ataaaggatt caccatgatt ggagagcact ctatttattg tactgtgaat aatgatgaag gagagtggag tggcccacca cctgaatgca gaggaaaatc tctaacttcc aaggtcccac caacagttca gaaacctacc acagtaaatg ttccaactac agaagtctca ccaacttctc agaaaaccac cacaaaaacc accacaccaa atgctcaagc aacacggagt acacctgttt ccaggacaac caagcatttt catgaaacaa ccccaaataa aggaagtgga accacttcag gtactacccg tcttctatct gggcacacgt gtttcacgtt gacaggtttg cttgggacgc tagtaaccat gggcttgctg acttag. It is sometimes possible for the material contained within the vial of "CD55, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.