Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD46 cdna clone

CD46 cDNA Clone

Gene Names
CD46; MCP; TLX; AHUS2; MIC10; TRA2.10
Synonyms
CD46; CD46 cDNA Clone; CD46 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcctcccggccgccgcgagtgtccctttccttcctggcgctttcctgggttgcttctggcggccatggtgttgctgctgtactccttctccgatgcctgtgaggagccaccaacatttgaagctatggagctcattggtaaaccaaaaccctactatgagattggtgaacgagtagattataagtgtaaaaaaggatacttctatatacctcctcttgccacccatactatttgtgatcggaatcatacatggctacctgtctcagatgacgcctgttatagagaaacatgtccatatatacgggatcctttaaatggccaagcagtccctgcaaatgggacttacgagtttggttatcagatgcactttatttgtaatgagggttattacttaattggtgaagaaattctatattgtgaacttaaaggatcagtagcaatttggagcggtaagcccccaatatgtgaaaaggttttgtgtacaccacctccaaaaataaaaaatggaaaacacacctttagtgaagtagaagtatttgagtatcttgatgcagtaacttatagttgtgatcctgcacctggaccagatccattttcacttattggagagagcacgatttattgtggtgacaattcagtgtggagtcgtgctgctccagagtgtaaagtggtcaaatgtcgatttccagtagtcgaaaatggaaaacagatatcaggatttggaaaaaaattttactacaaagcaacagttatgtttgaatgcgataagggtttttacctcgatggcagcgacacaattgtctgtgacagtaacagtacttgggatcccccagttccaaagtgtcttaaagtgtcgacttcttccactacaaaatctccagcgtccagtgcctcaggtcctaggcctacttacaagcctccagtctcaaattatccaggatatcctaaacctgaggaaggaatacttgacagtttggatgtttgggtcattgctgtgattgttattgccatagttgttggagttgcagtaatttgtgttgtcccgtacagatatcttcaaaggaggaagaagaaagggaaagcagatggtggagctgaatatgccacttaccagactaaatcaaccactccagcagagcagagaggctga
Sequence Length
1155
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,826 Da
NCBI Official Full Name
Homo sapiens CD46 molecule, complement regulatory protein, mRNA
NCBI Official Synonym Full Names
CD46 molecule
NCBI Official Symbol
CD46
NCBI Official Synonym Symbols
MCP; TLX; AHUS2; MIC10; TRA2.10
NCBI Protein Information
membrane cofactor protein
UniProt Protein Name
Membrane cofactor protein
Protein Family
UniProt Gene Name
CD46
UniProt Synonym Gene Names
MCP; MIC10
UniProt Entry Name
MCP_HUMAN

NCBI Description

The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]

Uniprot Description

CD46: Acts as a cofactor for complement factor I, a serine protease which protects autologous cells against complement- mediated injury by cleaving C3b and C4b deposited on host tissue. May be involved in the fusion of the spermatozoa with the oocyte during fertilization. Also acts as a costimulatory factor for T- cells which induces the differentiation of CD4+ into T-regulatory 1 cells. T-regulatory 1 cells suppress immune responses by secreting interleukin-10, and therefore are thought to prevent autoimmunity. A number of viral and bacterial pathogens seem to exploit this property and directly induce an immunosuppressive phenotype in T-cells by binding to CD46. Defects in CD46 are a cause of susceptibility to hemolytic uremic syndrome atypical type 2 (AHUS2). An atypical form of hemolytic uremic syndrome. It is a complex genetic disease characterized by microangiopathic hemolytic anemia, thrombocytopenia, renal failure and absence of episodes of enterocolitis and diarrhea. In contrast to typical hemolytic uremic syndrome, atypical forms have a poorer prognosis, with higher death rates and frequent progression to end-stage renal disease. Susceptibility to the development of atypical hemolytic uremic syndrome can be conferred by mutations in various components of or regulatory factors in the complement cascade system. Other genes may play a role in modifying the phenotype. Patients with CD46 mutations seem to have an overall better prognosis compared to patients carrying CFH mutations. 16 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell surface; Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: cell surface; focal adhesion; integral to plasma membrane; plasma membrane

Molecular Function: cadherin binding; protein binding; receptor activity

Biological Process: adaptive immune response; interleukin-10 production; positive regulation of interleukin-10 production; positive regulation of memory T cell differentiation; positive regulation of regulatory T cell differentiation; positive regulation of T cell proliferation; regulation of complement activation; regulation of Notch signaling pathway; T cell mediated immunity

Research Articles on CD46

Similar Products

Product Notes

The CD46 cd46 (Catalog #AAA1277308) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcctc ccggccgccg cgagtgtccc tttccttcct ggcgctttcc tgggttgctt ctggcggcca tggtgttgct gctgtactcc ttctccgatg cctgtgagga gccaccaaca tttgaagcta tggagctcat tggtaaacca aaaccctact atgagattgg tgaacgagta gattataagt gtaaaaaagg atacttctat atacctcctc ttgccaccca tactatttgt gatcggaatc atacatggct acctgtctca gatgacgcct gttatagaga aacatgtcca tatatacggg atcctttaaa tggccaagca gtccctgcaa atgggactta cgagtttggt tatcagatgc actttatttg taatgagggt tattacttaa ttggtgaaga aattctatat tgtgaactta aaggatcagt agcaatttgg agcggtaagc ccccaatatg tgaaaaggtt ttgtgtacac cacctccaaa aataaaaaat ggaaaacaca cctttagtga agtagaagta tttgagtatc ttgatgcagt aacttatagt tgtgatcctg cacctggacc agatccattt tcacttattg gagagagcac gatttattgt ggtgacaatt cagtgtggag tcgtgctgct ccagagtgta aagtggtcaa atgtcgattt ccagtagtcg aaaatggaaa acagatatca ggatttggaa aaaaatttta ctacaaagca acagttatgt ttgaatgcga taagggtttt tacctcgatg gcagcgacac aattgtctgt gacagtaaca gtacttggga tcccccagtt ccaaagtgtc ttaaagtgtc gacttcttcc actacaaaat ctccagcgtc cagtgcctca ggtcctaggc ctacttacaa gcctccagtc tcaaattatc caggatatcc taaacctgag gaaggaatac ttgacagttt ggatgtttgg gtcattgctg tgattgttat tgccatagtt gttggagttg cagtaatttg tgttgtcccg tacagatatc ttcaaaggag gaagaagaaa gggaaagcag atggtggagc tgaatatgcc acttaccaga ctaaatcaac cactccagca gagcagagag gctga. It is sometimes possible for the material contained within the vial of "CD46, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.