Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD3D cdna clone

CD3D cDNA Clone

Gene Names
CD3D; T3D; IMD19; CD3-DELTA
Synonyms
CD3D; CD3D cDNA Clone; CD3D cdna clone
Ordering
For Research Use Only!
Sequence
atggaacatagcacgtttctctctggcctggtactggctacccttctctcgcaagtgagccccttcaagatacctatagaggaacttgaggacagagtgtttgtgaattgcaataccagcatcacatgggtagagggaacggtgggaacactgctctcagacattacaagactggacctgggaaaacgcatcctggacccacgaggaatatataggtgtaatgggacagatatatacaaggacaaagaatctaccgtgcaagttcattatcgaatgtgccagagctgtgtggagctggatccagccaccgtggctggcatcattgtcactgatgtcattgccactctgctccttgctttgggagtcttctgctttgctggacatgagactggaaggctgtctggggctgccgacacacaagctctgttgaggaatgaccaggtctatcagcccctccgagatcgagatgatgctcagtacagccaccttggaggaaactgggctcggaacaagtga
Sequence Length
516
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
915
Molecular Weight
14,484 Da
NCBI Official Full Name
Homo sapiens CD3d molecule, delta (CD3-TCR complex), mRNA
NCBI Official Synonym Full Names
CD3d molecule
NCBI Official Symbol
CD3D
NCBI Official Synonym Symbols
T3D; IMD19; CD3-DELTA
NCBI Protein Information
T-cell surface glycoprotein CD3 delta chain
UniProt Protein Name
T-cell surface glycoprotein CD3 delta chain
UniProt Gene Name
CD3D
UniProt Synonym Gene Names
T3D
UniProt Entry Name
CD3D_HUMAN

NCBI Description

The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]

Uniprot Description

CD3D: a T cell surface glycoprotein that is a component of the T cell antigen receptor. A defect in this protein causes a severe combined immunodeficiency characterized by the absence of T cells but normal B cells. Contains 1 ITAM domain.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: plasma membrane; T cell receptor complex

Molecular Function: protein heterodimerization activity; transcription coactivator activity; transmembrane receptor activity

Biological Process: cell surface receptor linked signal transduction; positive regulation of transcription from RNA polymerase II promoter; positive thymic T cell selection; regulation of immune response; T cell costimulation; T cell differentiation; T cell receptor signaling pathway

Disease: Immunodeficiency 19

Research Articles on CD3D

Similar Products

Product Notes

The CD3D cd3d (Catalog #AAA1275073) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacata gcacgtttct ctctggcctg gtactggcta cccttctctc gcaagtgagc cccttcaaga tacctataga ggaacttgag gacagagtgt ttgtgaattg caataccagc atcacatggg tagagggaac ggtgggaaca ctgctctcag acattacaag actggacctg ggaaaacgca tcctggaccc acgaggaata tataggtgta atgggacaga tatatacaag gacaaagaat ctaccgtgca agttcattat cgaatgtgcc agagctgtgt ggagctggat ccagccaccg tggctggcat cattgtcact gatgtcattg ccactctgct ccttgctttg ggagtcttct gctttgctgg acatgagact ggaaggctgt ctggggctgc cgacacacaa gctctgttga ggaatgacca ggtctatcag cccctccgag atcgagatga tgctcagtac agccaccttg gaggaaactg ggctcggaac aagtga. It is sometimes possible for the material contained within the vial of "CD3D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.