CD300LG cdna clone
CD300LG cDNA Clone
Gene Names
CD300LG; CLM9; CLM-9; TREM4; TREM-4; NEPMUCIN
Synonyms
CD300LG; CD300LG cDNA Clone; CD300LG cdna clone
Sequence
atgcggcttctggtcctgctatggggttgcctgctgctcccaggttatgaagccctggagggcccagaggaaatcagcgggttcgaaggggacactgtgtccctgcagtgcacctacagggaagagctgagggaccaccggaagtactggtgcaggaagggtgggatcctcttctctcgctgctctggcaccatctatgcagaagaagaaggccaggagacaatgaagggcagggtgtccatccgtgacagccgccaggagctctcgctcattgtgaccctgtggaacctcaccctgcaagacgctggggagtactggtgtggggtcgaaaaacggggccccgatgagtctttactgatctctctgttcgtctttccaggaccctgctgtcctccctccccttctcccaccttccagcctctggctacaacacgcctgcagcccaaggcaaaagctcagcaaacccagcccccaggattgacttctcctgggctctacccggcagccaccacagccaagcaggggaagacaggggctgaggcccctccattgccagggacttcccagtacgggcacgaaaggacttctcagtacacaggaacctctcctcacccagcgacctctcctcctgcagggagctcccgcccccccatgcagctgaactccacctcagcagaggacaccagtccagctctcagcagtggcagctctaagcccagggtgtccatcccgatggtccgcatactggccccagtcctggtgctgctgagccttctgtcagccgcaggcctgatcgccttctgcagccacctgctcctgtggagaaaggaagctcaacaggccacggagacacagaggaacgagaagttctgcctctcacgcttgactgcggaggaaaaggaagccccttcccaggcccctgagggggacgtgatctcgatgcctcccctccacacatctgaggaggagctgggcttctcgaagtttgtctcagcgtag
Sequence Length
999
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,965 Da
NCBI Official Full Name
Homo sapiens CD300 molecule-like family member g, mRNA
NCBI Official Synonym Full Names
CD300 molecule like family member g
NCBI Official Symbol
CD300LG
NCBI Official Synonym Symbols
CLM9; CLM-9; TREM4; TREM-4; NEPMUCIN
NCBI Protein Information
CMRF35-like molecule 9
UniProt Protein Name
CMRF35-like molecule 9
Protein Family
UniProt Gene Name
CD300LG
UniProt Synonym Gene Names
CLM9; TREM4; CLM-9; TREM-4
UniProt Entry Name
CLM9_HUMAN
NCBI Description
Members of the CD300 (see MIM 606786)-like (CD300L) family, such as CD300LG, are widely expressed on hematopoietic cells. All CD300L proteins are type I cell surface glycoproteins that contain a single immunoglobulin (Ig) V-like domain (Takatsu et al., 2006 [PubMed 16876123]).[supplied by OMIM, Mar 2008]
Uniprot Description
CD300LG: Receptor which may mediate L-selectin-dependent lymphocyte rollings. Binds SELL in a calcium dependent manner. Binds lymphocyte. Belongs to the CD300 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 17q21.31
Cellular Component: plasma membrane
Molecular Function: protein binding
Biological Process: regulation of immune response
Research Articles on CD300LG
Similar Products
Product Notes
The CD300LG cd300lg (Catalog #AAA1272574) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggcttc tggtcctgct atggggttgc ctgctgctcc caggttatga agccctggag ggcccagagg aaatcagcgg gttcgaaggg gacactgtgt ccctgcagtg cacctacagg gaagagctga gggaccaccg gaagtactgg tgcaggaagg gtgggatcct cttctctcgc tgctctggca ccatctatgc agaagaagaa ggccaggaga caatgaaggg cagggtgtcc atccgtgaca gccgccagga gctctcgctc attgtgaccc tgtggaacct caccctgcaa gacgctgggg agtactggtg tggggtcgaa aaacggggcc ccgatgagtc tttactgatc tctctgttcg tctttccagg accctgctgt cctccctccc cttctcccac cttccagcct ctggctacaa cacgcctgca gcccaaggca aaagctcagc aaacccagcc cccaggattg acttctcctg ggctctaccc ggcagccacc acagccaagc aggggaagac aggggctgag gcccctccat tgccagggac ttcccagtac gggcacgaaa ggacttctca gtacacagga acctctcctc acccagcgac ctctcctcct gcagggagct cccgcccccc catgcagctg aactccacct cagcagagga caccagtcca gctctcagca gtggcagctc taagcccagg gtgtccatcc cgatggtccg catactggcc ccagtcctgg tgctgctgag ccttctgtca gccgcaggcc tgatcgcctt ctgcagccac ctgctcctgt ggagaaagga agctcaacag gccacggaga cacagaggaa cgagaagttc tgcctctcac gcttgactgc ggaggaaaag gaagcccctt cccaggcccc tgagggggac gtgatctcga tgcctcccct ccacacatct gaggaggagc tgggcttctc gaagtttgtc tcagcgtag. It is sometimes possible for the material contained within the vial of "CD300LG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
