Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCPG1 cdna clone

CCPG1 cDNA Clone

Gene Names
CCPG1; CPR8
Synonyms
CCPG1; CCPG1 cDNA Clone; CCPG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaacttttttcttaatagtattttcatctcagcctagtgacgatgtatcaagtagtgatgaaaccagtaatcagcccagtcctgcctttagacgacgccgtgctaggaagaagaccgtttctgcttcagaatctgaagaccggctagttgctgaacaagaaactgaaccttctaaggagttgagtaaacgtcagttcagtagtggtctcaataagtgtgttatacttgctttggtgattgcaatcagcatgggatttggccatttctatggcacaattcagattcagaagcgtcaacagttagtcagaaagatacatgaagatgaattgaatgatatgaaggattatctttcccagtgtcaacaggaacaagaatcttttatagattataagtcattgaaagaaaatcttgcaaggtgttggacacttactgaagcagagaagatgtcctttgaaactcagaaaacgaaccttgctacagaaaatcagtatttaagagtatccctggagaaggaagaaaaagccttatcctcattacaggaagagttaaacaaactaagagaacagattagaatattggaagataaagggacaagtactgaattagttaaagaaaatcagaaacttaagcagcatttggaagaggaaaagcagaaaaaacacagctttcttagtcaaagggagactctgttgacagaagcaaagatgctaaagagagaactggagagagaacgactagtaactacggctttaaggggggaactccagcagttaagtggtagtcagttacatggcaagtcagattctcccaatgtatatactgaaaaaaaggaaatagcaatcttacgggaaagactcactgagctggaactgaagctaaccttcgaacagcagcgttctgatttgtgggaaagattgtatgttgaggcaaaagatcaaaatggaaaacaaggaacagatggaaaaaagaaagggggcagaggaagccacagggctaaaaataagtcaaaggaaacatttttgggttcagttaaggaaacatttgatgccatgaagaattctaccaaggagtttgtaaggcatcataaagagaaaattaagcaggctaaagaagctgtgaaggaaaatctgaaaaaattctcagattcagttaaatccactttcagacactttaaagataccaccaagaatatctttgatgaaaagggtaataaaagatttggtgctacaaaagaagcagctgaaaaaccaagaacagtttttagtgactatttacatccacagtataaggcacctacagaaaaccatcataatagaggccctactatgcaaaatgatggaaggaaagaaaagccagttcactttaaagaattcagaaaaaatacaaattcaaagaaatgcagtcctgggcatgattgtagagaaaattctcattctttcagagaggcttgttctggtgtatttgattgtgctcaacaagagtccatgagcctttttaacatagtggtgaatcctataaggatggatgaatttagacagataattcaaaggtacatgttaaaagaactggatactttttgtcactggaacgaacttgatcagttcatcaataagtttttcctaaacggtgtctttatacatgatcagaagctcttcactgactttgttaatgatgttaaagattatcttagaaacatgaaggaatatgaagtagataatgatggagtatttgagaagttggatgaatatatatatagacacttctttggtcacactttttcccctccatatggacccaggtcggtttacataaaaccgtgtcattacagtagtttgtaa
Sequence Length
1842
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
93,488 Da
NCBI Official Full Name
Homo sapiens cell cycle progression 1, mRNA
NCBI Official Synonym Full Names
cell cycle progression 1
NCBI Official Symbol
CCPG1
NCBI Official Synonym Symbols
CPR8
NCBI Protein Information
cell cycle progression protein 1
UniProt Protein Name
Cell cycle progression protein 1
UniProt Gene Name
CCPG1
UniProt Synonym Gene Names
CCP8; CPR8; KIAA1254
UniProt Entry Name
CCPG1_HUMAN

Uniprot Description

CCPG1: Acts as an assembly platform for Rho protein signaling complexes. Limits guanine nucleotide exchange activity of MCF2L toward RHOA, which results in an inhibition of both its transcriptional activation ability and its transforming activity. Does not inhibit activity of MCF2L toward CDC42, or activity of MCF2 toward either RHOA or CDC42. May be involved in cell cycle regulation. Belongs to the CCPG1 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 15q21.1

Molecular Function: protein binding

Biological Process: positive regulation of cell cycle; positive regulation of cell proliferation

Similar Products

Product Notes

The CCPG1 ccpg1 (Catalog #AAA1266370) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaactt ttttcttaat agtattttca tctcagccta gtgacgatgt atcaagtagt gatgaaacca gtaatcagcc cagtcctgcc tttagacgac gccgtgctag gaagaagacc gtttctgctt cagaatctga agaccggcta gttgctgaac aagaaactga accttctaag gagttgagta aacgtcagtt cagtagtggt ctcaataagt gtgttatact tgctttggtg attgcaatca gcatgggatt tggccatttc tatggcacaa ttcagattca gaagcgtcaa cagttagtca gaaagataca tgaagatgaa ttgaatgata tgaaggatta tctttcccag tgtcaacagg aacaagaatc ttttatagat tataagtcat tgaaagaaaa tcttgcaagg tgttggacac ttactgaagc agagaagatg tcctttgaaa ctcagaaaac gaaccttgct acagaaaatc agtatttaag agtatccctg gagaaggaag aaaaagcctt atcctcatta caggaagagt taaacaaact aagagaacag attagaatat tggaagataa agggacaagt actgaattag ttaaagaaaa tcagaaactt aagcagcatt tggaagagga aaagcagaaa aaacacagct ttcttagtca aagggagact ctgttgacag aagcaaagat gctaaagaga gaactggaga gagaacgact agtaactacg gctttaaggg gggaactcca gcagttaagt ggtagtcagt tacatggcaa gtcagattct cccaatgtat atactgaaaa aaaggaaata gcaatcttac gggaaagact cactgagctg gaactgaagc taaccttcga acagcagcgt tctgatttgt gggaaagatt gtatgttgag gcaaaagatc aaaatggaaa acaaggaaca gatggaaaaa agaaaggggg cagaggaagc cacagggcta aaaataagtc aaaggaaaca tttttgggtt cagttaagga aacatttgat gccatgaaga attctaccaa ggagtttgta aggcatcata aagagaaaat taagcaggct aaagaagctg tgaaggaaaa tctgaaaaaa ttctcagatt cagttaaatc cactttcaga cactttaaag ataccaccaa gaatatcttt gatgaaaagg gtaataaaag atttggtgct acaaaagaag cagctgaaaa accaagaaca gtttttagtg actatttaca tccacagtat aaggcaccta cagaaaacca tcataataga ggccctacta tgcaaaatga tggaaggaaa gaaaagccag ttcactttaa agaattcaga aaaaatacaa attcaaagaa atgcagtcct gggcatgatt gtagagaaaa ttctcattct ttcagagagg cttgttctgg tgtatttgat tgtgctcaac aagagtccat gagccttttt aacatagtgg tgaatcctat aaggatggat gaatttagac agataattca aaggtacatg ttaaaagaac tggatacttt ttgtcactgg aacgaacttg atcagttcat caataagttt ttcctaaacg gtgtctttat acatgatcag aagctcttca ctgactttgt taatgatgtt aaagattatc ttagaaacat gaaggaatat gaagtagata atgatggagt atttgagaag ttggatgaat atatatatag acacttcttt ggtcacactt tttcccctcc atatggaccc aggtcggttt acataaaacc gtgtcattac agtagtttgt aa. It is sometimes possible for the material contained within the vial of "CCPG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.