Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNG1 cdna clone

CCNG1 cDNA Clone

Gene Names
CCNG1; CCNG
Synonyms
CCNG1; CCNG1 cDNA Clone; CCNG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatagaggtactgacaacaactgactctcagaaactgctacaccagctgaatgccctgttggaacaggagtctagatgtcagccaaaggtctgtggtttgagactaattgagtctgcacacgataatggcctcagaatgactgcaagactaagggactttgaagtaaaagatcttcttagtctaactcagttctttggctttgacacagagacattttctctagctgtgaatttactggacagattcctgtctaaaatgaaggtacagcccaagcaccttgggtgtgttggactgagctgcttttatttggctgtaaaatcaatagaagaggaaaggaatgtcccattggcaactgacttgatccgaataagtcaatataggtttacggtttcagacttgatgagaatggaaaagattgtattggagaaggtgtgttggaaagtcaaagctactactgcctttcaatttctgcaactgtattattcactccttcaagagaacttgccacttgaaaggagaaatagcattaattttgaaagactagaagctcaactgaaggcatgtcattgcaggatcatattttctaaagcaaagccttctgtgttggcattgtctatcattgcattagagatccaagcacagaagtgtgtagagttaacagaaggaatagaatgtcttcagaaacattccaagataaatggcagagatctgaccttctggcaagagcttgtatccaaatgtttaactgaatattcatcaaatgagtgttccaaaccaaatgttcagaagttgaaatggattgtttctgggcgtactgcacggcaattgaagcatagctactacagaataactcaccttccaacaattcctgaaatggtcccttaa
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
900
Molecular Weight
18,769 Da
NCBI Official Full Name
Homo sapiens cyclin G1, mRNA
NCBI Official Synonym Full Names
cyclin G1
NCBI Official Symbol
CCNG1
NCBI Official Synonym Symbols
CCNG
NCBI Protein Information
cyclin-G1
UniProt Protein Name
Cyclin-G1
Protein Family
UniProt Gene Name
CCNG1
UniProt Synonym Gene Names
CCNG; CYCG1; Cyclin-G
UniProt Entry Name
CCNG1_HUMAN

NCBI Description

The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CCNG1: May play a role in growth regulation. Is associated with G2/M phase arrest in response to DNA damage. May be an intermediate by which p53 mediates its role as an inhibitor of cellular proliferation. Belongs to the cyclin family. Cyclin G subfamily.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 5q32-q34

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: regulation of cyclin-dependent protein kinase activity

Research Articles on CCNG1

Similar Products

Product Notes

The CCNG1 ccng1 (Catalog #AAA1272913) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatagagg tactgacaac aactgactct cagaaactgc tacaccagct gaatgccctg ttggaacagg agtctagatg tcagccaaag gtctgtggtt tgagactaat tgagtctgca cacgataatg gcctcagaat gactgcaaga ctaagggact ttgaagtaaa agatcttctt agtctaactc agttctttgg ctttgacaca gagacatttt ctctagctgt gaatttactg gacagattcc tgtctaaaat gaaggtacag cccaagcacc ttgggtgtgt tggactgagc tgcttttatt tggctgtaaa atcaatagaa gaggaaagga atgtcccatt ggcaactgac ttgatccgaa taagtcaata taggtttacg gtttcagact tgatgagaat ggaaaagatt gtattggaga aggtgtgttg gaaagtcaaa gctactactg cctttcaatt tctgcaactg tattattcac tccttcaaga gaacttgcca cttgaaagga gaaatagcat taattttgaa agactagaag ctcaactgaa ggcatgtcat tgcaggatca tattttctaa agcaaagcct tctgtgttgg cattgtctat cattgcatta gagatccaag cacagaagtg tgtagagtta acagaaggaa tagaatgtct tcagaaacat tccaagataa atggcagaga tctgaccttc tggcaagagc ttgtatccaa atgtttaact gaatattcat caaatgagtg ttccaaacca aatgttcaga agttgaaatg gattgtttct gggcgtactg cacggcaatt gaagcatagc tactacagaa taactcacct tccaacaatt cctgaaatgg tcccttaa. It is sometimes possible for the material contained within the vial of "CCNG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.