Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNC cdna clone

CCNC cDNA Clone

Gene Names
CCNC; CycC
Synonyms
CCNC; CCNC cDNA Clone; CCNC cdna clone
Ordering
For Research Use Only!
Sequence
atggcagggaacttttggcagagctcccactatttgcaatggattttggataaacaagatctgttgaaggagcgccaaaaggatttaaagtttctctcagaggaagaatattggaagttacaaatattttttacaaatgttatccaagcattaggtgaacatcttaaattaagacaacaagttattgccactgctacggtatatttcaagagattctatgccaggtattctctgaaaagtatagatcctgtattaatggctcctacatgtgtgtttttggcatccaaagtagaggaatttggagtagtttcaaatacaagattgattgctgctgctacttctgtattaaaaactagattttcatatgcctttccaaaggaatttccttataggatgaatcatatattagaatgtgaattctatttgttagaactaatggattgttgcttgatagtgtatcatccttatagacctttgctccagtatgtgcaggacatgggccaagaagacatgttgcttccccttgcatggaggatagtgaatgatacctacagaacggatctttgcctactgtatcctcctttcatgatagctttagcttgcctacatgtagcctgtgttgtacagcagaaagatgccaggcaatggtttgctgagctttctgtggatatggaaaagattttggaaataatcagggttattttaaaactatatgagcagtggaagaatttcgatgagagaaaagagatggcaaccattcttagtaagatgccaaaaccaaaaccacctccaaacagtgaaggagagcagggtccaaatggaagtcagaactctagctacagccaatcttaa
Sequence Length
852
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
892
Molecular Weight
22,945 Da
NCBI Official Full Name
Homo sapiens cyclin C, mRNA
NCBI Official Synonym Full Names
cyclin C
NCBI Official Symbol
CCNC
NCBI Official Synonym Symbols
CycC
NCBI Protein Information
cyclin-C
UniProt Protein Name
Cyclin-C
UniProt Gene Name
CCNC
UniProt Synonym Gene Names
hSRB11
UniProt Entry Name
CCNC_HUMAN

NCBI Description

The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CCNC: Component of the Mediator complex, a coactivator involved in regulated gene transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Binds to and activates cyclin-dependent kinase CDK8 that phosphorylates the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAp II), which may inhibit the formation of a transcription initiation complex. Belongs to the cyclin family. Cyclin C subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: cyclin-dependent protein kinase holoenzyme complex; nucleoplasm; nucleus

Molecular Function: cyclin-dependent protein kinase regulator activity; protein binding; protein serine/threonine kinase activity

Biological Process: positive regulation of cyclin-dependent protein kinase activity; positive regulation of transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on CCNC

Similar Products

Product Notes

The CCNC ccnc (Catalog #AAA1272334) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggga acttttggca gagctcccac tatttgcaat ggattttgga taaacaagat ctgttgaagg agcgccaaaa ggatttaaag tttctctcag aggaagaata ttggaagtta caaatatttt ttacaaatgt tatccaagca ttaggtgaac atcttaaatt aagacaacaa gttattgcca ctgctacggt atatttcaag agattctatg ccaggtattc tctgaaaagt atagatcctg tattaatggc tcctacatgt gtgtttttgg catccaaagt agaggaattt ggagtagttt caaatacaag attgattgct gctgctactt ctgtattaaa aactagattt tcatatgcct ttccaaagga atttccttat aggatgaatc atatattaga atgtgaattc tatttgttag aactaatgga ttgttgcttg atagtgtatc atccttatag acctttgctc cagtatgtgc aggacatggg ccaagaagac atgttgcttc cccttgcatg gaggatagtg aatgatacct acagaacgga tctttgccta ctgtatcctc ctttcatgat agctttagct tgcctacatg tagcctgtgt tgtacagcag aaagatgcca ggcaatggtt tgctgagctt tctgtggata tggaaaagat tttggaaata atcagggtta ttttaaaact atatgagcag tggaagaatt tcgatgagag aaaagagatg gcaaccattc ttagtaagat gccaaaacca aaaccacctc caaacagtga aggagagcag ggtccaaatg gaagtcagaa ctctagctac agccaatctt aa. It is sometimes possible for the material contained within the vial of "CCNC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.