CCNB1IP1 cdna clone
CCNB1IP1 cDNA Clone
Gene Names
CCNB1IP1; HEI10; C14orf18
Synonyms
CCNB1IP1; CCNB1IP1 cDNA Clone; CCNB1IP1 cdna clone
Sequence
atgtctttgtgtgaagacatgctgctttgtaattatcgaaagtgtcgcatcaaactctctggctatgcatgggtcactgcctgctctcacatcttctgtgatcagcatggcagtggtgagtttagtcgctcaccagctatctgtcctgcctgcaacagtaccctttctggaaagctagatattgtccgcacagaactcagtccatcagaggaatataaagctatggtattggcaggactgcgaccagagatcgtgttggacattagctcccgagcgctggccttctggacatatcaggtacatcaggaacgtctctatcaagaatacaatttcagcaaggctgagggccatctgaaacagatggagaagatatatactcagcaaatacaaagcaaggatgtagaattgacctctatgaaaggggaggttacctccatgaagaaagtactagaagaatacaagaaaaagttcagtgacatctctgagaaacttatggagcgcaatcgtcagtatcaaaagctccaaggcctctatgatagccttaggctacgaaacatcactattgctaaccatgaaggcacccttgaaccatccatgattgcacagtctggtgttcttggcttcccattaggtaacaactccaagtttcctttggataatacacctgttcgaaatcggggcgatggagatggagattttcagttcagaccattttttgcgggttctcccacagcacctgaacccagcaacagcttttttagttttgtctctccaagtcgtgaattagagcagcagcaagtttctagcagggccttcaaagtaaaaagaatttga
Sequence Length
834
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,544 Da
NCBI Official Full Name
Homo sapiens cyclin B1 interacting protein 1, mRNA
NCBI Official Synonym Full Names
cyclin B1 interacting protein 1
NCBI Official Symbol
CCNB1IP1
NCBI Official Synonym Symbols
HEI10; C14orf18
NCBI Protein Information
E3 ubiquitin-protein ligase CCNB1IP1
UniProt Protein Name
E3 ubiquitin-protein ligase CCNB1IP1
Protein Family
UniProt Gene Name
CCNB1IP1
UniProt Synonym Gene Names
C14orf18; HEI10
UniProt Entry Name
CIP1_HUMAN
NCBI Description
HEI10 is a member of the E3 ubiquitin ligase family and functions in progression of the cell cycle through G(2)/M.[supplied by OMIM, Apr 2004]
Uniprot Description
CCNB1IP1: E3 ubiquitin-protein ligase. Modulates cyclin B levels and participates in the regulation of cell cycle progression through the G2 phase. Overexpression causes delayed entry into mitosis.
Protein type: Ubiquitin ligase; Motility/polarity/chemotaxis; EC 6.3.2.19; Ubiquitin conjugating system; Cell cycle regulation; EC 6.3.2.-; Ligase
Chromosomal Location of Human Ortholog: 14q11.2
Cellular Component: synaptonemal complex
Molecular Function: protein binding
Biological Process: chiasma formation; meiotic recombination; protein ubiquitination
Research Articles on CCNB1IP1
1. HEI10 defines a divergent class of E3 ubiquitin ligase, functioning in progression through G(2)/M.
Similar Products
Product Notes
The CCNB1IP1 ccnb1ip1 (Catalog #AAA1270625) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctttgt gtgaagacat gctgctttgt aattatcgaa agtgtcgcat caaactctct ggctatgcat gggtcactgc ctgctctcac atcttctgtg atcagcatgg cagtggtgag tttagtcgct caccagctat ctgtcctgcc tgcaacagta ccctttctgg aaagctagat attgtccgca cagaactcag tccatcagag gaatataaag ctatggtatt ggcaggactg cgaccagaga tcgtgttgga cattagctcc cgagcgctgg ccttctggac atatcaggta catcaggaac gtctctatca agaatacaat ttcagcaagg ctgagggcca tctgaaacag atggagaaga tatatactca gcaaatacaa agcaaggatg tagaattgac ctctatgaaa ggggaggtta cctccatgaa gaaagtacta gaagaataca agaaaaagtt cagtgacatc tctgagaaac ttatggagcg caatcgtcag tatcaaaagc tccaaggcct ctatgatagc cttaggctac gaaacatcac tattgctaac catgaaggca cccttgaacc atccatgatt gcacagtctg gtgttcttgg cttcccatta ggtaacaact ccaagtttcc tttggataat acacctgttc gaaatcgggg cgatggagat ggagattttc agttcagacc attttttgcg ggttctccca cagcacctga acccagcaac agctttttta gttttgtctc tccaagtcgt gaattagagc agcagcaagt ttctagcagg gccttcaaag taaaaagaat ttga. It is sometimes possible for the material contained within the vial of "CCNB1IP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
