Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL2 cdna clone

CCL2 cDNA Clone

Gene Names
CCL2; HC11; MCAF; MCP1; MCP-1; SCYA2; GDCF-2; SMC-CF; HSMCR30
Synonyms
CCL2; CCL2 cDNA Clone; CCL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagtctctgccgcccttctgtgcctgctgctcatagcagccaccttcattccccaagggctcgctcagccagatgcaatcaatgccccagtcacctgctgttataacttcaccaataggaagatctcagtgcagaggctcgcgagctatagaagaatcaccagcagcaagtgtcccaaagaagctgtgatcttcaagaccattgtggccaaggagatctgtgctgaccccaagcagaagtgggttcaggattccatggaccacctggacaagcaaacccaaactccgaagacttga
Sequence Length
300
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,025 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 2, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 2
NCBI Official Symbol
CCL2
NCBI Official Synonym Symbols
HC11; MCAF; MCP1; MCP-1; SCYA2; GDCF-2; SMC-CF; HSMCR30
NCBI Protein Information
C-C motif chemokine 2
UniProt Protein Name
C-C motif chemokine 2
Protein Family
UniProt Gene Name
CCL2
UniProt Synonym Gene Names
MCP1; SCYA2; MCAF; MCP-1
UniProt Entry Name
CCL2_HUMAN

NCBI Description

This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. [provided by RefSeq, Jul 2013]

Uniprot Description

CCL2: Chemotactic factor that attracts monocytes and basophils but not neutrophils or eosinophils. Augments monocyte anti-tumor activity. Has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis or atherosclerosis. May be involved in the recruitment of monocytes into the arterial wall during the disease process of atherosclerosis. Monomer or homodimer; in equilibrium. Binds to CCR2 and CCR4. Is tethered on endothelial cells by glycosaminoglycan (GAG) side chains of proteoglycans. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Chemokine; Secreted

Chromosomal Location of Human Ortholog: 17q11.2-q12

Cellular Component: extracellular region

Molecular Function: CCR2 chemokine receptor binding; protein kinase activity; receptor binding

Biological Process: angiogenesis; astrocyte cell migration; cell adhesion; cell surface receptor linked signal transduction; cellular homeostasis; chemotaxis; cytokine and chemokine mediated signaling pathway; cytoskeleton organization and biogenesis; G-protein coupled receptor protein signaling pathway; G-protein signaling, coupled to cyclic nucleotide second messenger; humoral immune response; inflammatory response; JAK-STAT cascade; lipopolysaccharide-mediated signaling pathway; macrophage chemotaxis; MAPKKK cascade; monocyte chemotaxis; negative regulation of neuron apoptosis; neutrophil chemotaxis; organ morphogenesis; positive regulation of GTPase activity; positive regulation of inflammatory response; positive regulation of nitric-oxide synthase biosynthetic process; positive regulation of T cell activation; protein amino acid phosphorylation; protein kinase B signaling cascade; regulation of cell shape; viral genome replication

Disease: Human Immunodeficiency Virus Type 1, Susceptibility To; Mycobacterium Tuberculosis, Susceptibility To; Neural Tube Defects

Research Articles on CCL2

Similar Products

Product Notes

The CCL2 ccl2 (Catalog #AAA1274409) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagtct ctgccgccct tctgtgcctg ctgctcatag cagccacctt cattccccaa gggctcgctc agccagatgc aatcaatgcc ccagtcacct gctgttataa cttcaccaat aggaagatct cagtgcagag gctcgcgagc tatagaagaa tcaccagcag caagtgtccc aaagaagctg tgatcttcaa gaccattgtg gccaaggaga tctgtgctga ccccaagcag aagtgggttc aggattccat ggaccacctg gacaagcaaa cccaaactcc gaagacttga. It is sometimes possible for the material contained within the vial of "CCL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.