Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL19 cdna clone

CCL19 cDNA Clone

Gene Names
CCL19; ELC; CKb11; MIP3B; MIP-3b; SCYA19
Synonyms
CCL19; CCL19 cDNA Clone; CCL19 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgctactggccctcagcctgctggttctctggacttccccagccccaactctgagtggcaccaatgatgctgaagactgctgcctgtctgtgacccagaaacccatccctgggtacatcgtgaggaacttccactaccttctcatcaaggatggctgcagggtgcctgctgtagtgttcaccacactgaggggccgccagctctgtgcacccccagaccagccctgggtagaacgcatcatccagagactgcagaggacctcagccaagatgaagcgccgcagcagttaa
Sequence Length
297
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,993 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 19, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 19
NCBI Official Symbol
CCL19
NCBI Official Synonym Symbols
ELC; CKb11; MIP3B; MIP-3b; SCYA19
NCBI Protein Information
C-C motif chemokine 19
UniProt Protein Name
C-C motif chemokine 19
Protein Family
UniProt Gene Name
CCL19
UniProt Synonym Gene Names
ELC; MIP3B; SCYA19; EBI1 ligand chemokine; ELC; MIP-3-beta
UniProt Entry Name
CCL19_HUMAN

NCBI Description

This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Sep 2014]

Uniprot Description

CCL19: May play a role not only in inflammatory and immunological responses but also in normal lymphocyte recirculation and homing. May play an important role in trafficking of T-cells in thymus, and T-cell and B-cell migration to secondary lymphoid organs. Specifically binds to chemokine receptor CCR7. Recombinant CCL19 shows potent chemotactic activity for T-cells and B-cells but not for granulocytes and monocytes. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Secreted; Motility/polarity/chemotaxis; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 9p13

Cellular Component: extracellular region; extracellular space

Molecular Function: CCR chemokine receptor binding; CCR10 chemokine receptor binding; CCR7 chemokine receptor binding; chemokine activity; chemokine receptor binding

Biological Process: activation of JNK activity; cell communication; cell maturation; cellular calcium ion homeostasis; dendritic cell chemotaxis; establishment of T cell polarity; formation of immunological synapse; G-protein coupled receptor protein signaling pathway; immune response; inflammatory response; lymphocyte chemotaxis; monocyte chemotaxis; myeloid dendritic cell chemotaxis; positive regulation of chemotaxis; positive regulation of dendritic cell antigen processing and presentation; positive regulation of endocytosis; positive regulation of GTPase activity; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-1 beta secretion; positive regulation of interleukin-12 production; positive regulation of JNK cascade; positive regulation of NF-kappaB import into nucleus; positive regulation of phosphoinositide 3-kinase activity; positive regulation of protein kinase activity; positive regulation of protein kinase B signaling cascade; positive regulation of receptor-mediated endocytosis; positive regulation of T cell proliferation; positive regulation of T-helper 1 cell differentiation; positive regulation of tumor necrosis factor production; release of sequestered calcium ion into cytosol; response to virus; T cell costimulation

Research Articles on CCL19

Similar Products

Product Notes

The CCL19 ccl19 (Catalog #AAA1275576) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctgc tactggccct cagcctgctg gttctctgga cttccccagc cccaactctg agtggcacca atgatgctga agactgctgc ctgtctgtga cccagaaacc catccctggg tacatcgtga ggaacttcca ctaccttctc atcaaggatg gctgcagggt gcctgctgta gtgttcacca cactgagggg ccgccagctc tgtgcacccc cagaccagcc ctgggtagaa cgcatcatcc agagactgca gaggacctca gccaagatga agcgccgcag cagttaa. It is sometimes possible for the material contained within the vial of "CCL19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.