Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL11 cdna clone

CCL11 cDNA Clone

Gene Names
CCL11; SCYA11
Synonyms
CCL11; CCL11 cDNA Clone; CCL11 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggtctccgcagcacttctgtggctgctgctcatagcagctgccttcagcccccaggggctcgctgggccagcttctgtcccaaccacctgctgctttaacctggccaataggaagataccccttcagcgactagagagctacaggagaatcaccagtggcaaatgtccccagaaagctgtgatcttcaagaccaaactggccaaggatatctgtgccgaccccaagaagaagtgggtgcaggattccatgaagtatctggaccaaaaatctccaactccaaagccataa
Sequence Length
294
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,732 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 11, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 11
NCBI Official Symbol
CCL11
NCBI Official Synonym Symbols
SCYA11
NCBI Protein Information
eotaxin
UniProt Protein Name
Eotaxin
Protein Family
UniProt Gene Name
CCL11
UniProt Synonym Gene Names
SCYA11
UniProt Entry Name
CCL11_HUMAN

NCBI Description

This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity for eosinophils, but not mononuclear cells or neutrophils. This eosinophil-specific chemokine is thought to be involved in eosinophilic inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma and parasitic infections. [provided by RefSeq, Sep 2014]

Uniprot Description

CCL11: In response to the presence of allergens, this protein directly promotes the accumulation of eosinophils, a prominent feature of allergic inflammatory reactions. Binds to CCR3. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Secreted; Secreted, signal peptide; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: extracellular region; extracellular space

Molecular Function: CCR chemokine receptor binding; chemokine activity; protein binding

Biological Process: cell adhesion; cellular calcium ion homeostasis; chemotaxis; cytoskeleton organization and biogenesis; eosinophil chemotaxis; G-protein coupled receptor protein signaling pathway; inflammatory response; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of actin filament polymerization; positive regulation of cell migration; positive regulation of endothelial cell proliferation; positive regulation of GTPase activity; positive regulation of inflammatory response; protein amino acid phosphorylation; regulation of cell shape; response to radiation; response to virus; signal transduction

Disease: Asthma, Susceptibility To; Human Immunodeficiency Virus Type 1, Susceptibility To

Research Articles on CCL11

Similar Products

Product Notes

The CCL11 ccl11 (Catalog #AAA1266504) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggtct ccgcagcact tctgtggctg ctgctcatag cagctgcctt cagcccccag gggctcgctg ggccagcttc tgtcccaacc acctgctgct ttaacctggc caataggaag ataccccttc agcgactaga gagctacagg agaatcacca gtggcaaatg tccccagaaa gctgtgatct tcaagaccaa actggccaag gatatctgtg ccgaccccaa gaagaagtgg gtgcaggatt ccatgaagta tctggaccaa aaatctccaa ctccaaagcc ataa. It is sometimes possible for the material contained within the vial of "CCL11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.