Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC67 cdna clone

CCDC67 cDNA Clone

Gene Names
DEUP1; CCDC67
Synonyms
CCDC67; CCDC67 cDNA Clone; CCDC67 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagcaggtctctcagaggtaaaaagtgagttacagtcacgtgatgatctcttgagaattatagaaatggaacgattgcaattacacagagaattattaaaaataggagagtgccaaaatgctcaaggaaataaaacaagacttgaatcatcttatttgccttctattaaagaaccagaaaggaaaataaaagagctgttttcagtgatgcaagatcaaccaaatcatgaaaaagaattgaacaagataagaagccaactccaacaggtggaagagtaccataactctgagcaggaaagaatgaggaatgaaatctctgacctaacagaagagcttcatcagaaggagatcactatagcaactgtcacaaagaaagctgcccttctggaaaaacagttaaaaatggaattagaaataaaagaaaaaatgttagcaaaacaaaaggtctcagatatgaaatataaagctgtcagaactgaaaacacacatctaaaaggaatgatgggagatttagaccccggagaatacatgagtatggacttcactaacagggaacagtcaaggcatacatctattaataaactgcaatatgagaatgaaaggctccgaaatgatcttgcaaaacttcatgtcaatggaaaatcaacctggactaatcaaaacacctatgaagaaacaggaagatatgcctatcaaagccaaataaaagtggaacaaaatgaagagagacttagtcatgactgtgagccaaacagaagtacaatgcctcccttgccaccttcgacatttcaagccaaagaaatgacaagtcctttggttagtgatgatgatgtattcccactgtctcccccagatatgtccttcccagcatctttggctgcacagcatttccttctggaagaagagaaacgagcaaaagaacttgaaaaacttctaaatacacatattgatgaactgcaaagacacacagaatttactcttaataaatactccaagctaaaacaaaatagacacatatga
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,111 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 67, mRNA
NCBI Official Synonym Full Names
deuterosome assembly protein 1
NCBI Official Symbol
DEUP1
NCBI Official Synonym Symbols
CCDC67
NCBI Protein Information
deuterosome protein 1
UniProt Protein Name
Deuterosome protein 1
Protein Family
UniProt Gene Name
CCDC67
UniProt Synonym Gene Names
DEUP1
UniProt Entry Name
DEUP1_HUMAN

Uniprot Description

CCDC67: Belongs to the CEP63 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 11q21

Cellular Component: centriole

Molecular Function: protein binding

Biological Process: centriole replication

Research Articles on CCDC67

Similar Products

Product Notes

The CCDC67 ccdc67 (Catalog #AAA1273228) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcag gtctctcaga ggtaaaaagt gagttacagt cacgtgatga tctcttgaga attatagaaa tggaacgatt gcaattacac agagaattat taaaaatagg agagtgccaa aatgctcaag gaaataaaac aagacttgaa tcatcttatt tgccttctat taaagaacca gaaaggaaaa taaaagagct gttttcagtg atgcaagatc aaccaaatca tgaaaaagaa ttgaacaaga taagaagcca actccaacag gtggaagagt accataactc tgagcaggaa agaatgagga atgaaatctc tgacctaaca gaagagcttc atcagaagga gatcactata gcaactgtca caaagaaagc tgcccttctg gaaaaacagt taaaaatgga attagaaata aaagaaaaaa tgttagcaaa acaaaaggtc tcagatatga aatataaagc tgtcagaact gaaaacacac atctaaaagg aatgatggga gatttagacc ccggagaata catgagtatg gacttcacta acagggaaca gtcaaggcat acatctatta ataaactgca atatgagaat gaaaggctcc gaaatgatct tgcaaaactt catgtcaatg gaaaatcaac ctggactaat caaaacacct atgaagaaac aggaagatat gcctatcaaa gccaaataaa agtggaacaa aatgaagaga gacttagtca tgactgtgag ccaaacagaa gtacaatgcc tcccttgcca ccttcgacat ttcaagccaa agaaatgaca agtcctttgg ttagtgatga tgatgtattc ccactgtctc ccccagatat gtccttccca gcatctttgg ctgcacagca tttccttctg gaagaagaga aacgagcaaa agaacttgaa aaacttctaa atacacatat tgatgaactg caaagacaca cagaatttac tcttaataaa tactccaagc taaaacaaaa tagacacata tga. It is sometimes possible for the material contained within the vial of "CCDC67, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.