Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC132 cdna clone

CCDC132 cDNA Clone

Gene Names
VPS50; VPS54L; CCDC132
Synonyms
CCDC132; CCDC132 cDNA Clone; CCDC132 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaaaaatcaaatctctcatgacccgacagggtctgaaaagccctcaagaaagcctcagtgatcttggtgccatagagagtctccgggtccctggaaaggaagaattcagggaacttcgagaacagccaagtgaccctcaagctgaacaagagcttattaatagtattgaacaagtatatttttctgtggattcatttgatattgttaaatatgagctggagaagcttccacctgttctcaatttgcaagaattagaggcgtatagagacaaattgaaacaacagcaagctgcagtatctaaaaaagtggcagatttaatccttgaaaaacagcctgcttatgtaaaggaactcgaaagagttacctcattgcagacaggtcttcaattagctgctgttatctgtacaaatgggagaagacacttgaatattgcaaaggaaggttttactcaagctagtttaggccttcttgcaaatcaaaggaaacgtcagttgctgattggacttctgaaatctctgagaactataaaaacattgcaaagaacagatgtacggttaagtgaaatgctggaggaggaagattatccaggagctattcagttgtgccttgaatgtcaaaaagctgccagcacttttaaacattacagttgtataagtgaactgaattcaaagctgcaagatactttggaacagattgaggaacagctggacgtagctctttccaaaatctgcaagaattttgacattaaccattataccaaggttcaacaagcttatcgacttcttggaaaaacacagacagcaatggatcaacttcatatgcacttcacccaagccattcacaacaccgtgtttcaagttgttcttggttatgtggaactatgtgcaggaaacacagacacaaaattccaaaagctgcaatataaggatctctgtacagtatgtagtgacttaattactattcatatatctctcctttag
Sequence Length
984
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
107,923 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 132, mRNA
NCBI Official Synonym Full Names
VPS50, EARP/GARPII complex subunit
NCBI Official Symbol
VPS50
NCBI Official Synonym Symbols
VPS54L; CCDC132
NCBI Protein Information
syndetin
UniProt Protein Name
Syndetin
UniProt Gene Name
VPS50
UniProt Entry Name
VPS50_HUMAN

Uniprot Description

CCDC132: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 7q21.3

Cellular Component: membrane; recycling endosome

Molecular Function: SNARE binding

Biological Process: endocytic recycling; retrograde transport, endosome to Golgi

Research Articles on CCDC132

Similar Products

Product Notes

The CCDC132 vps50 (Catalog #AAA1277203) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaaaaa tcaaatctct catgacccga cagggtctga aaagccctca agaaagcctc agtgatcttg gtgccataga gagtctccgg gtccctggaa aggaagaatt cagggaactt cgagaacagc caagtgaccc tcaagctgaa caagagctta ttaatagtat tgaacaagta tatttttctg tggattcatt tgatattgtt aaatatgagc tggagaagct tccacctgtt ctcaatttgc aagaattaga ggcgtataga gacaaattga aacaacagca agctgcagta tctaaaaaag tggcagattt aatccttgaa aaacagcctg cttatgtaaa ggaactcgaa agagttacct cattgcagac aggtcttcaa ttagctgctg ttatctgtac aaatgggaga agacacttga atattgcaaa ggaaggtttt actcaagcta gtttaggcct tcttgcaaat caaaggaaac gtcagttgct gattggactt ctgaaatctc tgagaactat aaaaacattg caaagaacag atgtacggtt aagtgaaatg ctggaggagg aagattatcc aggagctatt cagttgtgcc ttgaatgtca aaaagctgcc agcactttta aacattacag ttgtataagt gaactgaatt caaagctgca agatactttg gaacagattg aggaacagct ggacgtagct ctttccaaaa tctgcaagaa ttttgacatt aaccattata ccaaggttca acaagcttat cgacttcttg gaaaaacaca gacagcaatg gatcaacttc atatgcactt cacccaagcc attcacaaca ccgtgtttca agttgttctt ggttatgtgg aactatgtgc aggaaacaca gacacaaaat tccaaaagct gcaatataag gatctctgta cagtatgtag tgacttaatt actattcata tatctctcct ttag. It is sometimes possible for the material contained within the vial of "CCDC132, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.