Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC114 cdna clone

CCDC114 cDNA Clone

Gene Names
CCDC114; CILD20
Synonyms
CCDC114; CCDC114 cDNA Clone; CCDC114 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcgcaggtcctgcagcggcagatcttgcacctggagcagctgcaccacttcctcaagctcaagaacaacgaccggcagccggatcccgatgtcctggagaagcgtgaaaagcaggccggggaggtggccgagggcgtctggaagacctcccaggagaggctggtgctttgctacgaggatgccctgaataaactgtcccagctgatgggggagagtgaccctgacctgttggtgcagaagtatctggagatcgaggagcgcaactttgctgagttcaacttcatcaacgagcagaacttggagctggagcatgtgcaggaagagatcaaggagatgcaggaggctttggtgagcgcacgtgccagcaaggatgaccagcatttgctgcaggagcagcagcagaaggtgttgcagcagcgcatggacaaggtgcactcggaggctgagcgccttgaggcccgcttccaggatgtgcggggacagctggagaagctcaaggctgatatccagctcctcttcaccaaggcccattgcgacagcagcatgatcgatgacctccttggggtcaagaccagcatgggagaccgggacatgggcctcttcctgagcctcattgagaagcggctggtggagctcctgacagtgcaggccttcctacatgcccagagcttcacctccctggccgacgctgccctcctagtgctgggccagagcctggaggaccttccgaagaagatggccccacttcagccccctgacactctagaagaccccccgggttttgaggccagcgatgactaccccatgagcagggaggagctgctgagccaagtggagaagctggtggagctccaggagcaggcggaggcgcagcgccagaaggacctggccgccgccgccgcgaagctggacggcaccctgagcgtggacctggccagcacccagagggccggctccagtaccgtcctggtgcccaccaggcacccccatgccatccccgggtccattttgagccacaagactagcagagaccgtggctctcttggccacgtcacttttggcggcctcagctccagcactgggcatttgcccagccacatcacgcacggtgaccccaacactggccacgtgaccttcggctccaccagtgcctcgagtgggggccacgtgaccttcagacccgtcagcgccagcagctacctgggctccactggatacgtggggtccagcaggggcggagaaaacacagagggtggtgtggagagcggaggcacagcgtccgattcgagcggaggcctcgggtccagcagagaccacgtctccagcaccggccctgcctccagcactggcccgggctcctccaccagcaaagactcccggggctaa
Sequence Length
1392
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,694 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 114, mRNA
NCBI Official Synonym Full Names
coiled-coil domain containing 114
NCBI Official Symbol
CCDC114
NCBI Official Synonym Symbols
CILD20
NCBI Protein Information
coiled-coil domain-containing protein 114
UniProt Protein Name
Coiled-coil domain-containing protein 114
UniProt Gene Name
CCDC114
UniProt Entry Name
CC114_HUMAN

NCBI Description

This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]

Uniprot Description

CCDC114: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: axoneme; cilium

Molecular Function: protein binding

Disease: Ciliary Dyskinesia, Primary, 20

Research Articles on CCDC114

Similar Products

Product Notes

The CCDC114 ccdc114 (Catalog #AAA1276840) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgc aggtcctgca gcggcagatc ttgcacctgg agcagctgca ccacttcctc aagctcaaga acaacgaccg gcagccggat cccgatgtcc tggagaagcg tgaaaagcag gccggggagg tggccgaggg cgtctggaag acctcccagg agaggctggt gctttgctac gaggatgccc tgaataaact gtcccagctg atgggggaga gtgaccctga cctgttggtg cagaagtatc tggagatcga ggagcgcaac tttgctgagt tcaacttcat caacgagcag aacttggagc tggagcatgt gcaggaagag atcaaggaga tgcaggaggc tttggtgagc gcacgtgcca gcaaggatga ccagcatttg ctgcaggagc agcagcagaa ggtgttgcag cagcgcatgg acaaggtgca ctcggaggct gagcgccttg aggcccgctt ccaggatgtg cggggacagc tggagaagct caaggctgat atccagctcc tcttcaccaa ggcccattgc gacagcagca tgatcgatga cctccttggg gtcaagacca gcatgggaga ccgggacatg ggcctcttcc tgagcctcat tgagaagcgg ctggtggagc tcctgacagt gcaggccttc ctacatgccc agagcttcac ctccctggcc gacgctgccc tcctagtgct gggccagagc ctggaggacc ttccgaagaa gatggcccca cttcagcccc ctgacactct agaagacccc ccgggttttg aggccagcga tgactacccc atgagcaggg aggagctgct gagccaagtg gagaagctgg tggagctcca ggagcaggcg gaggcgcagc gccagaagga cctggccgcc gccgccgcga agctggacgg caccctgagc gtggacctgg ccagcaccca gagggccggc tccagtaccg tcctggtgcc caccaggcac ccccatgcca tccccgggtc cattttgagc cacaagacta gcagagaccg tggctctctt ggccacgtca cttttggcgg cctcagctcc agcactgggc atttgcccag ccacatcacg cacggtgacc ccaacactgg ccacgtgacc ttcggctcca ccagtgcctc gagtgggggc cacgtgacct tcagacccgt cagcgccagc agctacctgg gctccactgg atacgtgggg tccagcaggg gcggagaaaa cacagagggt ggtgtggaga gcggaggcac agcgtccgat tcgagcggag gcctcgggtc cagcagagac cacgtctcca gcaccggccc tgcctccagc actggcccgg gctcctccac cagcaaagac tcccggggct aa. It is sometimes possible for the material contained within the vial of "CCDC114, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.