CBLL1 cdna clone
CBLL1 cDNA Clone
Gene Names
CBLL1; HAKAI; RNF188
Synonyms
CBLL1; CBLL1 cDNA Clone; CBLL1 cdna clone
Sequence
atggatcacactgacaatgagttacaaggcactaatagttctggatccttgggtggtcttgatgttcgcagacgaattcctataaagctcatctccaaacaagcaaacaaagcgaaacctgcaccgcgaactcaaagaactataaacaggatgcctgcaaaggctccacctggtgatgaagaaggatttgattataatgaagaagaacggtatgactgtaaagggggtgagctgtttgcaaatcagcgaagatttcctggacaccttttttgggactttcagataaacatcttaggtgaaaaggatgatacaccagttcatttctgtgacaagtgtggattgcctattaaaatctatgggagaatgattccatgcaagcatgttttttgctatgactgtgctattttacatgaaaaaaagggagataagatgtgtccaggctgtagtgatcctgtgcagcgaattgagcagtgtacacgaggttctctcttcatgtgtagcattgttcaagggtgcaagagaacatatttgtctcagagagacttacaggctcatatcaaccatcgccatatgagagctggaaaacctgttacccgtgcttcacttgaaaatgttcatcctcctattgccccaccaccaactgaaatccctgagcgttttataatgccaccagacaagcaccatatgagccatattccgccaaagcagcacatcatgatgccaccacctcctttgcaacatgtgccacatgagcactataatcagccacatgaggatattcgtgctcctccagcagaattgtccatggctccacctccacctcgatcggtcagtcaggaaacctttcgtatttcaacaagaaaacacagcaatttaataaccgtccctattcaggatgactcaaattcaggtgctagagaaccaccacctcctgccccagcacctgctcaccatcatcctgaatatcagggtcaaccagtggtatcgcaccctcatcatattatgcctccacagcaacattatgcaccacccccacctcctccaccaccaataagccatccaatgccacatcctccccaggctgcaggtactcctcacttggtatatagccaagctccacctccaccaatgacctctgctccaccaccaataacccctccccctggacatattattgcccagatgccaccttatatgaatcatcctcctccaggacctcccccacctcaacatggtggtccacctgtaactgcaccccctcctcaccattataatcctaactcattaccccagttcactgaagatcaaggaactctgagccctccatttacacaaccagggggaatgagtcctggtatatggcctgcaccaagagggccaccaccacctccacgattgcagggtccgccttctcaaaccccacttcctggaccacatcatccagatcagacaagatatagaccgtattaccaatga
Sequence Length
1476
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,390 Da
NCBI Official Full Name
Homo sapiens Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1, mRNA
NCBI Official Synonym Full Names
Cbl proto-oncogene like 1
NCBI Official Symbol
CBLL1
NCBI Official Synonym Symbols
HAKAI; RNF188
NCBI Protein Information
E3 ubiquitin-protein ligase Hakai
UniProt Protein Name
E3 ubiquitin-protein ligase Hakai
Protein Family
UniProt Gene Name
CBLL1
UniProt Synonym Gene Names
HAKAI; RNF188
UniProt Entry Name
HAKAI_HUMAN
NCBI Description
This gene encodes an E3 ubiquitin-ligase for the E-cadherin complex and mediates its ubiquitination, endocytosis, and degradation in the lysosomes. The encoded protein contains a RING-finger domain and is also thought to have a role in control of cell proliferation. A related pseudogene has been identified on chromosome X. Alternative splicing results in a non-coding transcript variant. [provided by RefSeq, Aug 2011]
Uniprot Description
CBLL1: Promotes ubiquitination of tyrosine-phosphorylated CDH1, thus targeting CDH1 for endocytosis and degradation.
Protein type: EC 6.3.2.-; Motility/polarity/chemotaxis; Ubiquitin conjugating system; Ubiquitin ligase; Cell adhesion; EC 6.3.2.19; C2H2-type zinc finger protein; Ligase
Chromosomal Location of Human Ortholog: 7q22.3
Cellular Component: ubiquitin ligase complex
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: cell-cell adhesion; negative regulation of cell adhesion; positive regulation of cell migration; positive regulation of endocytosis; protein ubiquitination; regulation of cell adhesion
Research Articles on CBLL1
Similar Products
Product Notes
The CBLL1 cbll1 (Catalog #AAA1266698) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcaca ctgacaatga gttacaaggc actaatagtt ctggatcctt gggtggtctt gatgttcgca gacgaattcc tataaagctc atctccaaac aagcaaacaa agcgaaacct gcaccgcgaa ctcaaagaac tataaacagg atgcctgcaa aggctccacc tggtgatgaa gaaggatttg attataatga agaagaacgg tatgactgta aagggggtga gctgtttgca aatcagcgaa gatttcctgg acaccttttt tgggactttc agataaacat cttaggtgaa aaggatgata caccagttca tttctgtgac aagtgtggat tgcctattaa aatctatggg agaatgattc catgcaagca tgttttttgc tatgactgtg ctattttaca tgaaaaaaag ggagataaga tgtgtccagg ctgtagtgat cctgtgcagc gaattgagca gtgtacacga ggttctctct tcatgtgtag cattgttcaa gggtgcaaga gaacatattt gtctcagaga gacttacagg ctcatatcaa ccatcgccat atgagagctg gaaaacctgt tacccgtgct tcacttgaaa atgttcatcc tcctattgcc ccaccaccaa ctgaaatccc tgagcgtttt ataatgccac cagacaagca ccatatgagc catattccgc caaagcagca catcatgatg ccaccacctc ctttgcaaca tgtgccacat gagcactata atcagccaca tgaggatatt cgtgctcctc cagcagaatt gtccatggct ccacctccac ctcgatcggt cagtcaggaa acctttcgta tttcaacaag aaaacacagc aatttaataa ccgtccctat tcaggatgac tcaaattcag gtgctagaga accaccacct cctgccccag cacctgctca ccatcatcct gaatatcagg gtcaaccagt ggtatcgcac cctcatcata ttatgcctcc acagcaacat tatgcaccac ccccacctcc tccaccacca ataagccatc caatgccaca tcctccccag gctgcaggta ctcctcactt ggtatatagc caagctccac ctccaccaat gacctctgct ccaccaccaa taacccctcc ccctggacat attattgccc agatgccacc ttatatgaat catcctcctc caggacctcc cccacctcaa catggtggtc cacctgtaac tgcaccccct cctcaccatt ataatcctaa ctcattaccc cagttcactg aagatcaagg aactctgagc cctccattta cacaaccagg gggaatgagt cctggtatat ggcctgcacc aagagggcca ccaccacctc cacgattgca gggtccgcct tctcaaaccc cacttcctgg accacatcat ccagatcaga caagatatag accgtattac caatga. It is sometimes possible for the material contained within the vial of "CBLL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
