Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CASP10 cdna clone

CASP10 cDNA Clone

Gene Names
CASP10; MCH4; ALPS2; FLICE2
Synonyms
CASP10; CASP10 cDNA Clone; CASP10 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaatctcaaggtcaacattggtattccagttcagataaaaactgtaaagtgagctttcgtgagaagcttctgattattgattcaaacctgggggtccaagatgtggagaacctcaagtttctctgcataggattggtccccaacaagaagctggagaagtccagctcagcctcagatgtttttgaacatctcttggcagaggatctgctgagtgaggaagaccctttcttcctggcagaactcctctatatcatacggcagaagaagctgctgcagcacctcaactgtaccaaagaggaagtggagcgactgctgcccacccgacaaagggtttctctgtttagaaacctgctctacgaactgtcagaaggcattgactcagagaacttaaaggacatgatcttccttctgaaagactcgcttcccaaaactgaaatgacctccctaagtttcctggcatttctagagaaacaaggtaaaatagatgaagataatctgacatgcctggaggacctctgcaaaacagttgtacctaaacttttgagaaacatagagaaatacaaaagagagaaagctatccagatagtgacacctcctgtagacaaggaagccgagtcgtatcaaggagaggaagaactagtttcccaaacagatgttaagacattcttggaagccttaccgcaggagtcctggcaaaataagcatgcaggtagtaatggtaacagagccacaaatggtgcaccaagcctggtctccagggggatgcaaggagcatctgctaacactctaaactctgaaaccagcacaaagagggcagctgtgtacaggatgaatcggaaccacagaggcctctgtgtcattgtcaacaaccacagctttacctccctgaaggacagacaaggaacccataaagatgctgagatcctgagtcatgtgttccagtggcttgggttcacagtgcatatacacaataatgtgacgaaagtggaaatggagatggtcctgcagaagcagaagtgcaatccagcccatgccgacggggactgcttcgtgttctgtattctgacccatgggagatttggagctgtctactcttcggatgaggccctcattcccattcgggagatcatgtctcacttcacagccctgcagtgccctagactggctgaaaaacctaaactctttttcatccaggcctgccaaggtgaagagatacagccttccgtatccatcgaagcagatgctctgaaccctgagcaggcacccacttccctgcaggacagtattcctgccgaggctgacttcctacttggtctggccactgtcccaggctatgtatcctttcggcatgtggaggaaggcagctggtatattcagtctctgtgtaatcatctgaagaaattggtcccaagacatgaagacatcttatccatcctcactgctgtcaacgatgatgtgagtcgaagagtggacaaacagggaacaaagaaacagatgccccagcctgctttcacactaaggaaaaaactagtattccctgtgcccctggatgcactttcattatag
Sequence Length
1569
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
843
Molecular Weight
28,364 Da
NCBI Official Full Name
Homo sapiens caspase 10, apoptosis-related cysteine peptidase, mRNA
NCBI Official Synonym Full Names
caspase 10
NCBI Official Symbol
CASP10
NCBI Official Synonym Symbols
MCH4; ALPS2; FLICE2
NCBI Protein Information
caspase-10
UniProt Protein Name
Caspase-10
Protein Family
UniProt Gene Name
CASP10
UniProt Synonym Gene Names
MCH4; CASP-10; FLICE2
UniProt Entry Name
CASPA_HUMAN

NCBI Description

This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]

Uniprot Description

CASP10: Involved in the activation cascade of caspases responsible for apoptosis execution. Recruited to both Fas- and TNFR-1 receptors in a FADD dependent manner. May participate in the granzyme B apoptotic pathways. Cleaves and activates caspase- 3, -4, -6, -7, -8, and -9. Hydrolyzes the small- molecule substrates, Tyr-Val-Ala-Asp-|-AMC and Asp-Glu-Val-Asp-|-AMC. Heterotetramer that consists of two anti-parallel arranged heterodimers, each one formed by a 23/17 kDa (p23/17) (depending on the splicing events) and a 12 kDa (p12) subunit. Self-associates. Interacts with FADD and CASP8. Found in a Fas signaling complex consisting of FAS, FADD, CASP8 and CASP10. Detectable in most tissues. Lowest expression is seen in brain, kidney, prostate, testis and colon. Belongs to the peptidase C14A family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; EC 3.4.22.63

Chromosomal Location of Human Ortholog: 2q33-q34

Cellular Component: CD95 death-inducing signaling complex; cytosol

Molecular Function: cysteine-type endopeptidase activity; protein binding; ubiquitin protein ligase binding

Biological Process: apoptosis; cell surface receptor linked signal transduction; induction of apoptosis via death domain receptors; macrophage differentiation; positive regulation of I-kappaB kinase/NF-kappaB cascade; regulation of apoptosis

Disease: Autoimmune Lymphoproliferative Syndrome, Type Iia; Gastric Cancer; Lymphoma, Non-hodgkin, Familial

Research Articles on CASP10

Similar Products

Product Notes

The CASP10 casp10 (Catalog #AAA1273908) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaatctc aaggtcaaca ttggtattcc agttcagata aaaactgtaa agtgagcttt cgtgagaagc ttctgattat tgattcaaac ctgggggtcc aagatgtgga gaacctcaag tttctctgca taggattggt ccccaacaag aagctggaga agtccagctc agcctcagat gtttttgaac atctcttggc agaggatctg ctgagtgagg aagacccttt cttcctggca gaactcctct atatcatacg gcagaagaag ctgctgcagc acctcaactg taccaaagag gaagtggagc gactgctgcc cacccgacaa agggtttctc tgtttagaaa cctgctctac gaactgtcag aaggcattga ctcagagaac ttaaaggaca tgatcttcct tctgaaagac tcgcttccca aaactgaaat gacctcccta agtttcctgg catttctaga gaaacaaggt aaaatagatg aagataatct gacatgcctg gaggacctct gcaaaacagt tgtacctaaa cttttgagaa acatagagaa atacaaaaga gagaaagcta tccagatagt gacacctcct gtagacaagg aagccgagtc gtatcaagga gaggaagaac tagtttccca aacagatgtt aagacattct tggaagcctt accgcaggag tcctggcaaa ataagcatgc aggtagtaat ggtaacagag ccacaaatgg tgcaccaagc ctggtctcca gggggatgca aggagcatct gctaacactc taaactctga aaccagcaca aagagggcag ctgtgtacag gatgaatcgg aaccacagag gcctctgtgt cattgtcaac aaccacagct ttacctccct gaaggacaga caaggaaccc ataaagatgc tgagatcctg agtcatgtgt tccagtggct tgggttcaca gtgcatatac acaataatgt gacgaaagtg gaaatggaga tggtcctgca gaagcagaag tgcaatccag cccatgccga cggggactgc ttcgtgttct gtattctgac ccatgggaga tttggagctg tctactcttc ggatgaggcc ctcattccca ttcgggagat catgtctcac ttcacagccc tgcagtgccc tagactggct gaaaaaccta aactcttttt catccaggcc tgccaaggtg aagagataca gccttccgta tccatcgaag cagatgctct gaaccctgag caggcaccca cttccctgca ggacagtatt cctgccgagg ctgacttcct acttggtctg gccactgtcc caggctatgt atcctttcgg catgtggagg aaggcagctg gtatattcag tctctgtgta atcatctgaa gaaattggtc ccaagacatg aagacatctt atccatcctc actgctgtca acgatgatgt gagtcgaaga gtggacaaac agggaacaaa gaaacagatg ccccagcctg ctttcacact aaggaaaaaa ctagtattcc ctgtgcccct ggatgcactt tcattatag. It is sometimes possible for the material contained within the vial of "CASP10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.