CAPNS2 cdna clone
CAPNS2 cDNA Clone
Synonyms
CAPNS2; CAPNS2 cDNA Clone; CAPNS2 cdna clone
Sequence
atgtttcttgcaaaggctctattggaaggagcagatcgaggtcttggagaagctcttggaggcctctttggaggaggtggtcagagaagagaaggaggaggaagaaatattggagggatagttggaggaattgtgaattttatcagtgaggctgcagcagctcagtatactccagaaccgcctcccactcagcagcatttcaccagtgtggaggcctcagaaagtgaggaagttaggcgatttcggcaacaatttacacagctggctggaccagacatggaggtgggtgccactgatctgatgaatattctcaacaaagtcctttctaagcacaaagatcttaagactgacggttttagtcttgacacctgccggagcattgtgtctgtcatggacagtgacacgactggtaagctgggctttgaagaatttaagtatctgtggaacaacatcaagaaatggcagtgtgtttataagcagtatgacagggaccattctgggtctctgggaagttctcagctgcggggagctctgcaggccgcaggcttccagctaaatgaacaactttaccaaatgattgtccgccggtatgctaatgaagatggagatatggattttaacaatttcatcagctgcttggtccgcctggatgccatgtttcgtgccttcaagtctctggatagagatagagatggcctgattcaagtgtctatcaaagaatggctgcagttgaccatgtattcctga
Sequence Length
747
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,660 Da
NCBI Official Full Name
Homo sapiens calpain, small subunit 2, mRNA
NCBI Official Synonym Full Names
calpain small subunit 2
NCBI Official Symbol
CAPNS2
NCBI Protein Information
calpain small subunit 2
UniProt Protein Name
Calpain small subunit 2
Protein Family
UniProt Gene Name
CAPNS2
UniProt Synonym Gene Names
CSS2
UniProt Entry Name
CPNS2_HUMAN
Uniprot Description
CAPNS2: Calcium-regulated non-lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. This small subunit may act as a tissue-specific chaperone of the large subunit, possibly by helping it fold into its correct conformation for activity.
Chromosomal Location of Human Ortholog: 16q12.2
Cellular Component: cytoplasm; cytosol
Molecular Function: calcium-dependent cysteine-type endopeptidase activity
Biological Process: extracellular matrix disassembly; proteolysis
Research Articles on CAPNS2
Similar Products
Product Notes
The CAPNS2 capns2 (Catalog #AAA1272389) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttcttg caaaggctct attggaagga gcagatcgag gtcttggaga agctcttgga ggcctctttg gaggaggtgg tcagagaaga gaaggaggag gaagaaatat tggagggata gttggaggaa ttgtgaattt tatcagtgag gctgcagcag ctcagtatac tccagaaccg cctcccactc agcagcattt caccagtgtg gaggcctcag aaagtgagga agttaggcga tttcggcaac aatttacaca gctggctgga ccagacatgg aggtgggtgc cactgatctg atgaatattc tcaacaaagt cctttctaag cacaaagatc ttaagactga cggttttagt cttgacacct gccggagcat tgtgtctgtc atggacagtg acacgactgg taagctgggc tttgaagaat ttaagtatct gtggaacaac atcaagaaat ggcagtgtgt ttataagcag tatgacaggg accattctgg gtctctggga agttctcagc tgcggggagc tctgcaggcc gcaggcttcc agctaaatga acaactttac caaatgattg tccgccggta tgctaatgaa gatggagata tggattttaa caatttcatc agctgcttgg tccgcctgga tgccatgttt cgtgccttca agtctctgga tagagataga gatggcctga ttcaagtgtc tatcaaagaa tggctgcagt tgaccatgta ttcctga. It is sometimes possible for the material contained within the vial of "CAPNS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
