Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPNS1 cdna clone

CAPNS1 cDNA Clone

Gene Names
CAPNS1; CANP; CDPS; CSS1; CANPS; CAPN4; CALPAIN4
Synonyms
CAPNS1; CAPNS1 cDNA Clone; CAPNS1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcctggttaactcgttcttgaagggcggcggcggcggcggcgggggaggcgggggcctgggtgggggcctgggaaatgtgcttggaggcctgatcagcggggccgggggcggcggcggcggcggcggcggcggcggcggtggtggaggcggcggtggcggtggaacggccatgcgcatcctaggcggagtcatcagcgccatcagcgaggcggctgcgcagtacaacccggagcccccgcccccacgcacacattactccaacattgaggccaacgagagtgaggaggtccggcagttccggagactctttgcccagctggctggagatgacatggaggtcagcgccacagaactcatgaacattctcaataaggttgtgacacgacaccctgatctgaagactgatggttttggcattgacacatgtcgcagcatggtggccgtgatggatagcgacaccacaggcaagctgggctttgaggaattcaagtacttgtggaacaacatcaaaaggtggcaggccatatacaaacagttcgacactgaccgatcagggaccatttgcagtagtgaactcccaggtgcctttgaggcagcagggttccacctgaatgagcatctctataacatgatcatccgacgctactcagatgaaagtgggaacatggattttgacaacttcatcagctgcttggtcaggctggacgccatgttccgtgccttcaaatctcttgacaaagatggcactggacaaatccaggtgaacatccaggagtggctgcagctgactatgtattcctga
Sequence Length
807
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
826
Molecular Weight
28,316 Da
NCBI Official Full Name
Homo sapiens calpain, small subunit 1, mRNA
NCBI Official Synonym Full Names
calpain small subunit 1
NCBI Official Symbol
CAPNS1
NCBI Official Synonym Symbols
CANP; CDPS; CSS1; CANPS; CAPN4; CALPAIN4
NCBI Protein Information
calpain small subunit 1
UniProt Protein Name
Calpain small subunit 1
Protein Family
UniProt Gene Name
CAPNS1
UniProt Synonym Gene Names
CAPN4; CAPNS; CSS1; CANP small subunit; CDPS
UniProt Entry Name
CPNS1_HUMAN

NCBI Description

This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Uniprot Description

CAPNS1: Regulatory subunit of the calcium-regulated non- lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction.

Protein type: Motility/polarity/chemotaxis; Protease

Chromosomal Location of Human Ortholog: 19q13.12

Cellular Component: cytosol; membrane

Molecular Function: calcium-dependent cysteine-type endopeptidase activity; protein binding

Biological Process: extracellular matrix disassembly; positive regulation of cell proliferation

Research Articles on CAPNS1

Similar Products

Product Notes

The CAPNS1 capns1 (Catalog #AAA1267193) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcctgg ttaactcgtt cttgaagggc ggcggcggcg gcggcggggg aggcgggggc ctgggtgggg gcctgggaaa tgtgcttgga ggcctgatca gcggggccgg gggcggcggc ggcggcggcg gcggcggcgg cggtggtgga ggcggcggtg gcggtggaac ggccatgcgc atcctaggcg gagtcatcag cgccatcagc gaggcggctg cgcagtacaa cccggagccc ccgcccccac gcacacatta ctccaacatt gaggccaacg agagtgagga ggtccggcag ttccggagac tctttgccca gctggctgga gatgacatgg aggtcagcgc cacagaactc atgaacattc tcaataaggt tgtgacacga caccctgatc tgaagactga tggttttggc attgacacat gtcgcagcat ggtggccgtg atggatagcg acaccacagg caagctgggc tttgaggaat tcaagtactt gtggaacaac atcaaaaggt ggcaggccat atacaaacag ttcgacactg accgatcagg gaccatttgc agtagtgaac tcccaggtgc ctttgaggca gcagggttcc acctgaatga gcatctctat aacatgatca tccgacgcta ctcagatgaa agtgggaaca tggattttga caacttcatc agctgcttgg tcaggctgga cgccatgttc cgtgccttca aatctcttga caaagatggc actggacaaa tccaggtgaa catccaggag tggctgcagc tgactatgta ttcctga. It is sometimes possible for the material contained within the vial of "CAPNS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.