Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPN7 cdna clone

CAPN7 cDNA Clone

Gene Names
CAPN7; PALBH; CALPAIN7
Synonyms
CAPN7; CAPN7 cDNA Clone; CAPN7 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgccacagcactggagcgggacgctgtgcagttcgcccgtctggcggttcagcgcgaccacgaaggccgctactccgaggcggtgttttattacaaggaagctgcacaagccttaatttatgctgagatggcaggatcaagcctagaaaatattcaagaaaaaataactgagtatctggaaagagttcaagctctacattcagcagttcagtcaaagagtgctgatcctttgaagtcaaaacatcagttggacttagagcgtgctcatttccttgttacacaagcttttgatgaagatgaaaaagagaatgttgaagatgctatagaattgtacacagaagctgtggatctctgtctgaaaacatcttatgaaactgctgataaagtcctgcaaaataaactgaaacagttggctcgacaggcgctagacagagcagaagcgctgggtgagcctttgaccaagccagttggcaaaatcagttcaacaagtgttaagccaaagccacctccagagagagcacattttccactgggcgctaatcccttccttgaaagacctcagtcatttataagtcctcagtcatgtgatgcacaaggacagagatacacagcagaagaaatagaagtactcaggacaacatcaaaaataaatggtatagaatatgttcctttcatgaatgttgacctgagagaacgttttgcctatccaatgcctttctgtgatagatggggcaagctaccattatcacctaaacaaaaaactacattttccaagtgggtacgaccagaagacctcaccaacaatcctacaatgatatatactgtgtccagttttagcataaagcagacaatagtatcggattgctcctttgtggcatcactggccatcagtgcagcttatgaaagacgttttaataagaagttaattaccggcataatttaccctcaaaacaaggatggtgaaccagaatacaatccatgtgggaagtatatggtaaaacttcacctcaatggtgtcccaagaaaggtgataattgatgaccagttacctgttgatcacaagggagaattgctctgttcttattccaacaacaaaagtgaattatgggtttctctcatagaaaaagcatacatgaaagtcatgggaggatatgattttccaggatccaactccaatattgatcttcatgcactgactggctggataccagaaagaattgctatgcattcagatagccaaactttcagtaaggataattctttcagaatgctttatcaaagatttcacaaaggagatgtcctcatcactgcgtcaactggaatgatgacagaagctgaaggagagaagtggggtctggttcccacacacgcatatgctgttttggatattagagagttcaaggggctgcgatttatccagttgaaaaatccttggagtcatttacgttggaaaggaagatacagtgaaaatgatgtagaaaactggaccccagagttgcaaaagtatttaaactttgatccccgaacagctcagaaaatagacaacggaatattttggatttcctgggatgatctctgccagtattatgatgtgatttatttgagttggaatccaggtctttttaaagaatcaacatgtattcacagtacttgggatgctaagcaaggacctgtgaaagatgcctatagcctggccaacaacccccagtacaaactggaggtgcagtgtccacaggggggtgctgcagtttgggttttgcttagtagacacataacagacaaggatgattttgcgaataatcgagaatttatcacaatggttgtatacaagactgatgggaaaaaagtttattacccagctgacccacctccatacattgatggaattcgaattaacagccctcattatttgactaagataaagctgaccacacctggcacccatacctttacattagtggtttctcaatatgaaaaacagaacacaatccattacacggttcgggtatattcagcatgcagctttactttttcaaagattccttcaccatacaccttatcaaaacggattaatggaaagtggagtggtcagagtgctggaggatgtggaaatttccaagagactcacaaaaataaccccatctaccaattccatatagaaaagactgggccgttactgattgagctacgaggaccaaggcaatatagcgttggatttgaggttgtaacagtttctactctaggagatcctggtccccatggctttctgaggaaatctagtggtgactataggtgtgggttttgctacctggaattagaaaatataccttctgggatcttcaatatcattcctagtacctttttgcctaaacaagaaggaccttttttcttggactttaatagtattatccccatcaagatcacacaacttcagtga
Sequence Length
2442
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,652 Da
NCBI Official Full Name
Homo sapiens calpain 7, mRNA
NCBI Official Synonym Full Names
calpain 7
NCBI Official Symbol
CAPN7
NCBI Official Synonym Symbols
PALBH; CALPAIN7
NCBI Protein Information
calpain-7
UniProt Protein Name
Calpain-7
Protein Family
UniProt Gene Name
CAPN7
UniProt Synonym Gene Names
PALBH; PalBH
UniProt Entry Name
CAN7_HUMAN

NCBI Description

Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]

Uniprot Description

CAPN7: Calcium-regulated non-lysosomal thiol-protease. Belongs to the peptidase C2 family.

Protein type: Motility/polarity/chemotaxis; EC 3.4.22.-; Protease

Chromosomal Location of Human Ortholog: 3p24

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: calcium-dependent cysteine-type endopeptidase activity; endopeptidase activity; protein binding

Research Articles on CAPN7

Similar Products

Product Notes

The CAPN7 capn7 (Catalog #AAA1268607) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgcca cagcactgga gcgggacgct gtgcagttcg cccgtctggc ggttcagcgc gaccacgaag gccgctactc cgaggcggtg ttttattaca aggaagctgc acaagcctta atttatgctg agatggcagg atcaagccta gaaaatattc aagaaaaaat aactgagtat ctggaaagag ttcaagctct acattcagca gttcagtcaa agagtgctga tcctttgaag tcaaaacatc agttggactt agagcgtgct catttccttg ttacacaagc ttttgatgaa gatgaaaaag agaatgttga agatgctata gaattgtaca cagaagctgt ggatctctgt ctgaaaacat cttatgaaac tgctgataaa gtcctgcaaa ataaactgaa acagttggct cgacaggcgc tagacagagc agaagcgctg ggtgagcctt tgaccaagcc agttggcaaa atcagttcaa caagtgttaa gccaaagcca cctccagaga gagcacattt tccactgggc gctaatccct tccttgaaag acctcagtca tttataagtc ctcagtcatg tgatgcacaa ggacagagat acacagcaga agaaatagaa gtactcagga caacatcaaa aataaatggt atagaatatg ttcctttcat gaatgttgac ctgagagaac gttttgccta tccaatgcct ttctgtgata gatggggcaa gctaccatta tcacctaaac aaaaaactac attttccaag tgggtacgac cagaagacct caccaacaat cctacaatga tatatactgt gtccagtttt agcataaagc agacaatagt atcggattgc tcctttgtgg catcactggc catcagtgca gcttatgaaa gacgttttaa taagaagtta attaccggca taatttaccc tcaaaacaag gatggtgaac cagaatacaa tccatgtggg aagtatatgg taaaacttca cctcaatggt gtcccaagaa aggtgataat tgatgaccag ttacctgttg atcacaaggg agaattgctc tgttcttatt ccaacaacaa aagtgaatta tgggtttctc tcatagaaaa agcatacatg aaagtcatgg gaggatatga ttttccagga tccaactcca atattgatct tcatgcactg actggctgga taccagaaag aattgctatg cattcagata gccaaacttt cagtaaggat aattctttca gaatgcttta tcaaagattt cacaaaggag atgtcctcat cactgcgtca actggaatga tgacagaagc tgaaggagag aagtggggtc tggttcccac acacgcatat gctgttttgg atattagaga gttcaagggg ctgcgattta tccagttgaa aaatccttgg agtcatttac gttggaaagg aagatacagt gaaaatgatg tagaaaactg gaccccagag ttgcaaaagt atttaaactt tgatccccga acagctcaga aaatagacaa cggaatattt tggatttcct gggatgatct ctgccagtat tatgatgtga tttatttgag ttggaatcca ggtcttttta aagaatcaac atgtattcac agtacttggg atgctaagca aggacctgtg aaagatgcct atagcctggc caacaacccc cagtacaaac tggaggtgca gtgtccacag gggggtgctg cagtttgggt tttgcttagt agacacataa cagacaagga tgattttgcg aataatcgag aatttatcac aatggttgta tacaagactg atgggaaaaa agtttattac ccagctgacc cacctccata cattgatgga attcgaatta acagccctca ttatttgact aagataaagc tgaccacacc tggcacccat acctttacat tagtggtttc tcaatatgaa aaacagaaca caatccatta cacggttcgg gtatattcag catgcagctt tactttttca aagattcctt caccatacac cttatcaaaa cggattaatg gaaagtggag tggtcagagt gctggaggat gtggaaattt ccaagagact cacaaaaata accccatcta ccaattccat atagaaaaga ctgggccgtt actgattgag ctacgaggac caaggcaata tagcgttgga tttgaggttg taacagtttc tactctagga gatcctggtc cccatggctt tctgaggaaa tctagtggtg actataggtg tgggttttgc tacctggaat tagaaaatat accttctggg atcttcaata tcattcctag tacctttttg cctaaacaag aaggaccttt tttcttggac tttaatagta ttatccccat caagatcaca caacttcagt ga. It is sometimes possible for the material contained within the vial of "CAPN7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.