C9orf46 cdna clone
C9orf46 cDNA Clone
Gene Names
PLGRKT; AD025; MDS030; C9orf46; PLG-RKT; Plg-R(KT)
Synonyms
C9orf46; C9orf46 cDNA Clone; C9orf46 cdna clone
Sequence
atggggtttatattttcaaaatctatgaatgaaagcatgaaaaatcaaaaggagttcatgcttatgaatgctcgacttcagctggaaaggcagctcatcatgcagagtgaaatgagggaaagacaaatggccatgcagattgcgtggtctcgggaattcctcaaatattttggaactttttttggccttgcagccatctctttaacagctggagcgattaaaaaaaagaagccagccttcctggtcccgattgttccattaagctttatcctcacctaccagtatgacttgggctatggaacccttttagaaagaatgaaaggtgaagctgaggacatactggaaacagaaaagagtaaattgcagctgccaagaggaatgatcacttttgaaagcattgaaaaagccagaaaggaacagagtagattcttcatagacaaatga
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,201 Da
NCBI Official Full Name
Homo sapiens chromosome 9 open reading frame 46, mRNA
NCBI Official Synonym Full Names
plasminogen receptor with a C-terminal lysine
NCBI Official Symbol
PLGRKT
NCBI Official Synonym Symbols
AD025; MDS030; C9orf46; PLG-RKT; Plg-R(KT)
NCBI Protein Information
plasminogen receptor (KT)
UniProt Protein Name
Plasminogen receptor (KT)
UniProt Gene Name
PLGRKT
UniProt Synonym Gene Names
C9orf46; Plg-R(KT)
UniProt Entry Name
PLRKT_HUMAN
Uniprot Description
PLGRKT: Receptor for plasminogen. Regulates urokinase plasminogen activator-dependent and stimulates tissue-type plasminogen activator-dependent cell surface plasminogen activation. Proposed to be part of a local catecholaminergic cell plasminogen activation system that regulates neuroendocrine prohormone processing. Involved in regulation of inflammatory response; regulates monocyte chemotactic migration and matrix metallproteinase activation, such as of MMP2 and MMP9.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 9p24.1
Molecular Function: protein binding
Research Articles on C9orf46
Similar Products
Product Notes
The C9orf46 plgrkt (Catalog #AAA1275150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggttta tattttcaaa atctatgaat gaaagcatga aaaatcaaaa ggagttcatg cttatgaatg ctcgacttca gctggaaagg cagctcatca tgcagagtga aatgagggaa agacaaatgg ccatgcagat tgcgtggtct cgggaattcc tcaaatattt tggaactttt tttggccttg cagccatctc tttaacagct ggagcgatta aaaaaaagaa gccagccttc ctggtcccga ttgttccatt aagctttatc ctcacctacc agtatgactt gggctatgga acccttttag aaagaatgaa aggtgaagct gaggacatac tggaaacaga aaagagtaaa ttgcagctgc caagaggaat gatcactttt gaaagcattg aaaaagccag aaaggaacag agtagattct tcatagacaa atga. It is sometimes possible for the material contained within the vial of "C9orf46, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
