C9orf41 cdna clone
C9orf41 cDNA Clone
Gene Names
CARNMT1; C9orf41; UPF0586
Synonyms
C9orf41; C9orf41 cDNA Clone; C9orf41 cdna clone
Sequence
atgcagcgacggcgtcgccctccgccgcccacctcccggctgcccgagggctgcgggggaggaggcggtggcagcgaggaggtggaagtgcagttttccgccgggcgttggggctcggccgcggcggtttcggcggcagcggcggcggccacgcgcagcaccgaggaggaggaggagaggcttgagcgtgagcacttctggaagatcattaatgccttccgctactacggcaccagtatgcatgagcgggtgaaccgaacagaaagacagtttcgatcacttccagctaaccaacagaaactacttcctcagtttcttcttcacttggacaagatccggaaatgcattgatcataatcaagaaatactactgaccattgtgaatgattgcatacatatgtttgaaaataaagaatatggagaagatgggaatggaaagattatgccagcatctacatttgacatggataagttaaaatccacgctgaaacagtttgtgagagactggagtgaaactgggaaagcagaaagggatgcctgttaccagccaatcattaaagaaattttaaaaaattttccaaaagagagatgggatccttctaaagtaaatattctggtacctggtgctggactaggaagactggcctgggaaatagctatgctaggttatgcttgtcaaggaaatgaatggagtttttttatgctcttttcttccaactttgtactcaacagatgttctgaaattaataaatataaactttatccttggatccatcagtttagcaataaccggagatcagctgatcagattcgacccatctttttccctgatgttgacccccacagtcttcctcctggttctaacttttctatgacagcaggagattttcaagagatttattcagaatgcaatacctgggactgtattgctacctgtttcttcatagacacagctcacaatgtaattgattatattgatacaatatggaaaatactcaagccaggtggaatttggataaatctaggtcctctgctgtaccactttgaaaatctggcaaatgaactttccatagaattgagctatgaggatataaaaaacgttgttctgcagtatggattcaaggtagaggtggaaaaagaatctgtattgtcaacatatactgtgaatgatctctctatgatgaaatactactatgaatgtgtcttgtttgtggtccgtaagccacaataa
Sequence Length
1230
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,186 Da
NCBI Official Full Name
Homo sapiens chromosome 9 open reading frame 41, mRNA
NCBI Official Synonym Full Names
carnosine N-methyltransferase 1
NCBI Official Symbol
CARNMT1
NCBI Official Synonym Symbols
C9orf41; UPF0586
NCBI Protein Information
carnosine N-methyltransferase
UniProt Protein Name
Carnosine N-methyltransferase
UniProt Gene Name
CARNMT1
UniProt Entry Name
CARME_HUMAN
NCBI Description
The protein encoded by this gene is a methyltransferase that converts carnosine to anserine, a dipeptide found abundantly in skeletal muscle. The encoded protein can methylate other dipeptides as well. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Uniprot Description
CARNMT1: Belongs to the UPF0586 family.
Chromosomal Location of Human Ortholog: 9q21.13
Cellular Component: cytosol; nucleus
Molecular Function: carnosine N-methyltransferase activity
Similar Products
Product Notes
The C9orf41 carnmt1 (Catalog #AAA1275685) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagcgac ggcgtcgccc tccgccgccc acctcccggc tgcccgaggg ctgcggggga ggaggcggtg gcagcgagga ggtggaagtg cagttttccg ccgggcgttg gggctcggcc gcggcggttt cggcggcagc ggcggcggcc acgcgcagca ccgaggagga ggaggagagg cttgagcgtg agcacttctg gaagatcatt aatgccttcc gctactacgg caccagtatg catgagcggg tgaaccgaac agaaagacag tttcgatcac ttccagctaa ccaacagaaa ctacttcctc agtttcttct tcacttggac aagatccgga aatgcattga tcataatcaa gaaatactac tgaccattgt gaatgattgc atacatatgt ttgaaaataa agaatatgga gaagatggga atggaaagat tatgccagca tctacatttg acatggataa gttaaaatcc acgctgaaac agtttgtgag agactggagt gaaactggga aagcagaaag ggatgcctgt taccagccaa tcattaaaga aattttaaaa aattttccaa aagagagatg ggatccttct aaagtaaata ttctggtacc tggtgctgga ctaggaagac tggcctggga aatagctatg ctaggttatg cttgtcaagg aaatgaatgg agttttttta tgctcttttc ttccaacttt gtactcaaca gatgttctga aattaataaa tataaacttt atccttggat ccatcagttt agcaataacc ggagatcagc tgatcagatt cgacccatct ttttccctga tgttgacccc cacagtcttc ctcctggttc taacttttct atgacagcag gagattttca agagatttat tcagaatgca atacctggga ctgtattgct acctgtttct tcatagacac agctcacaat gtaattgatt atattgatac aatatggaaa atactcaagc caggtggaat ttggataaat ctaggtcctc tgctgtacca ctttgaaaat ctggcaaatg aactttccat agaattgagc tatgaggata taaaaaacgt tgttctgcag tatggattca aggtagaggt ggaaaaagaa tctgtattgt caacatatac tgtgaatgat ctctctatga tgaaatacta ctatgaatgt gtcttgtttg tggtccgtaa gccacaataa. It is sometimes possible for the material contained within the vial of "C9orf41, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
