Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C8orf38 cdna clone

C8orf38 cDNA Clone

Gene Names
NDUFAF6; C8orf38
Synonyms
C8orf38; C8orf38 cDNA Clone; C8orf38 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcctccgcgcacggctctgtctgggggccgttgcggcttggcatccccggcctgtgctgccgccggccgcctctgggtctgtacgcgcgcatgcggcggctgcccgggccggaggtgtctgggcggagcgtggctgcggccagcggaccgggcgcctggggcactgaccactactgcctggagctgctgcggaaacgggattatgaaggttatttatgctccctgctgctccctgcagaatcccgaagctctgtttttgcactgagggcctttaatgtggaactggctcaggctggattactcttgctgctgtcttgctgtactgtatgccactgggatctgaacactaaacattgctaa
Sequence Length
366
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,125 Da
NCBI Official Full Name
Homo sapiens chromosome 8 open reading frame 38, mRNA
NCBI Official Synonym Full Names
NADH:ubiquinone oxidoreductase complex assembly factor 6
NCBI Official Symbol
NDUFAF6
NCBI Official Synonym Symbols
C8orf38
NCBI Protein Information
NADH dehydrogenase (ubiquinone) complex I, assembly factor 6
UniProt Protein Name
NADH dehydrogenase (ubiquinone) complex I, assembly factor 6
UniProt Gene Name
NDUFAF6
UniProt Synonym Gene Names
C8orf38
UniProt Entry Name
NDUF6_HUMAN

NCBI Description

This gene encodes a protein that localizes to mitochondria and contains a predicted phytoene synthase domain. The encoded protein plays an important role in the assembly of complex I (NADH-ubiquinone oxidoreductase) of the mitochondrial respiratory chain through regulation of subunit ND1 biogenesis. Mutations in this gene are associated with complex I enzymatic deficiency. [provided by RefSeq, Nov 2011]

Uniprot Description

NDUFAF6: Involved in the assembly of mitochondrial NADH:ubiquinone oxidoreductase complex (complex I) at early stages. May play a role in the biogenesis of MT-ND1. Defects in NDUFAF6 are a cause of mitochondrial complex I deficiency (MT-C1D). A disorder of the mitochondrial respiratory chain that causes a wide range of clinical disorders, from lethal neonatal disease to adult-onset neurodegenerative disorders. Phenotypes include macrocephaly with progressive leukodystrophy, non-specific encephalopathy, cardiomyopathy, myopathy, liver disease, Leigh syndrome, Leber hereditary optic neuropathy, and some forms of Parkinson disease. Belongs to the NDUFAF6 family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 8q22.1

Cellular Component: integral to membrane; mitochondrial inner membrane

Molecular Function: transmembrane transporter activity

Biological Process: mitochondrial respiratory chain complex I assembly

Disease: Leigh Syndrome

Research Articles on C8orf38

Similar Products

Product Notes

The C8orf38 ndufaf6 (Catalog #AAA1268323) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcct ccgcgcacgg ctctgtctgg gggccgttgc ggcttggcat ccccggcctg tgctgccgcc ggccgcctct gggtctgtac gcgcgcatgc ggcggctgcc cgggccggag gtgtctgggc ggagcgtggc tgcggccagc ggaccgggcg cctggggcac tgaccactac tgcctggagc tgctgcggaa acgggattat gaaggttatt tatgctccct gctgctccct gcagaatccc gaagctctgt ttttgcactg agggccttta atgtggaact ggctcaggct ggattactct tgctgctgtc ttgctgtact gtatgccact gggatctgaa cactaaacat tgctaa. It is sometimes possible for the material contained within the vial of "C8orf38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.