Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C5AR1 cdna clone

C5AR1 cDNA Clone

Gene Names
C5AR1; C5A; C5AR; C5R1; CD88
Synonyms
C5AR1; C5AR1 cDNA Clone; C5AR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactccttcaattataccacccctgattatgggcactatgatgacaaggataccctggacctcaacacccctgtggataaaacttctaacacgctgcgtgttccagacatcctggccttggtcatctttgcagtcgtcttcctggtgggagtgctgggcaatgccctggtggtctgggtgacggcattcgaggccaagcggaccatcaatgccatctggttcctcaacttggcggtagccgacttcctctcctgcctggcgctgcccatcttgttcacgtccattgtacagcatcaccactggccctttggcggggccgcctgcagcatcctgccctccctcatcctgctcaacatgtacgccagcatcctgctcctggccaccatcagcgccgaccgctttctgctggtgtttaaacccatctggtgccagaacttccgaggggccggcttggcctggatcgcctgtgccgtggcttggggtttagccctgctgctgaccataccctccttcctgtaccgggtggtccgggaggagtactttccaccaaaggtgttgtgtggcgtggactacagccacgacaaacggcgggagcgagccgtggccatcgtccggctggtcctgggcttcctgtggcctctactcacgctcacgatttgttacactttcatcctgctccggacgtggagccgcagggccacgcggtccaccaagacactcaaggtggtggtggcagtggtggccagtttctttatcttctggttgccctaccaggtgacggggataatgatgtccttcctggagccatcgtcacccaccttcctgctgctgaataagctggactccctgtgtgtctcctttgcctacatcaactgctgcatcaaccccatcatctacgtggtggccggccagggcttccagggccgactgcggaaatccctccccagcctcctccggaacgtgttgactgaagagtccgtggttagggagagcaagtcattcacgcgctccacagtggacactatggcccagaagacccaggcagtgtag
Sequence Length
1053
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
728
Molecular Weight
39,336 Da
NCBI Official Full Name
Homo sapiens complement component 5a receptor 1, mRNA
NCBI Official Synonym Full Names
complement C5a receptor 1
NCBI Official Symbol
C5AR1
NCBI Official Synonym Symbols
C5A; C5AR; C5R1; CD88
NCBI Protein Information
C5a anaphylatoxin chemotactic receptor 1
UniProt Protein Name
C5a anaphylatoxin chemotactic receptor 1
UniProt Gene Name
C5AR1
UniProt Synonym Gene Names
C5AR; C5R1; C5a-R; C5aR
UniProt Entry Name
C5AR1_HUMAN

Uniprot Description

C5aR: a family 1 G-protein coupled receptor that stimulates the GTPase activity of Gi2. Receptor for the chemotactic and inflammatory complement factor C5a. Stimulates chemotaxis, granule enzyme release and superoxide anion production. Phosphorylated in response to C5a or after stimulation of cells with phorbol esters. Expressed on monocytes, granulocytes, dendritic cells, astrocytes and microglia.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR; GPCR, family 1

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: apical part of cell; basolateral plasma membrane; integral to plasma membrane; plasma membrane

Molecular Function: complement component C5a receptor activity

Biological Process: activation of MAPK activity; cellular defense response; chemotaxis; immune response; mRNA transcription from RNA polymerase II promoter; phospholipase C activation; positive regulation of epithelial cell proliferation; regulation of complement activation; sensory perception of chemical stimulus; signal transduction

Research Articles on C5AR1

Similar Products

Product Notes

The C5AR1 c5ar1 (Catalog #AAA1276679) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactcct tcaattatac cacccctgat tatgggcact atgatgacaa ggataccctg gacctcaaca cccctgtgga taaaacttct aacacgctgc gtgttccaga catcctggcc ttggtcatct ttgcagtcgt cttcctggtg ggagtgctgg gcaatgccct ggtggtctgg gtgacggcat tcgaggccaa gcggaccatc aatgccatct ggttcctcaa cttggcggta gccgacttcc tctcctgcct ggcgctgccc atcttgttca cgtccattgt acagcatcac cactggccct ttggcggggc cgcctgcagc atcctgccct ccctcatcct gctcaacatg tacgccagca tcctgctcct ggccaccatc agcgccgacc gctttctgct ggtgtttaaa cccatctggt gccagaactt ccgaggggcc ggcttggcct ggatcgcctg tgccgtggct tggggtttag ccctgctgct gaccataccc tccttcctgt accgggtggt ccgggaggag tactttccac caaaggtgtt gtgtggcgtg gactacagcc acgacaaacg gcgggagcga gccgtggcca tcgtccggct ggtcctgggc ttcctgtggc ctctactcac gctcacgatt tgttacactt tcatcctgct ccggacgtgg agccgcaggg ccacgcggtc caccaagaca ctcaaggtgg tggtggcagt ggtggccagt ttctttatct tctggttgcc ctaccaggtg acggggataa tgatgtcctt cctggagcca tcgtcaccca ccttcctgct gctgaataag ctggactccc tgtgtgtctc ctttgcctac atcaactgct gcatcaaccc catcatctac gtggtggccg gccagggctt ccagggccga ctgcggaaat ccctccccag cctcctccgg aacgtgttga ctgaagagtc cgtggttagg gagagcaagt cattcacgcg ctccacagtg gacactatgg cccagaagac ccaggcagtg tag. It is sometimes possible for the material contained within the vial of "C5AR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.