C4orf27 cdna clone
C4orf27 cDNA Clone
Gene Names
HPF1; C4orf27
Synonyms
C4orf27; C4orf27 cDNA Clone; C4orf27 cdna clone
Sequence
atggtcggcggtggcgggaagcgcaggcccggcggggaggggccgcagtgtgaaaaaacaactgatgtgaagaaaagtaaattctgtgaagctgatgtctccagtgaccttcgaaaagaagtagaaaatcattataagctttctttacctgaagatttctatcacttctggaagttctgtgaagaacttgatcctgaaaagccatctgattcactttctgcaagccttggacttcaattagttggtccttatgatatccttgctggaaaacataaaacgaagaaaaaatcaacaggcctgaattttaaccttcactggaggttttactatgatcctcctgagttccagaccattattattggagataataaaactcagtaccacatggggtatttcagggattctcctgatgaatttcctgtatatgttggtataaatgaagcaaagaaaaattgtataattgttccaaatggagataatgtatttgctgcagtcaaattatttttgacgaaaaaacttaaagaaataacggataaaaagaaaatcaatctcttgaaaaacatagatgaaaaactcacagaagcagccagagaattggggtactcgcttgaacagagaaccgtgaagatgaaacagagagataagaaagttgtgacaaagacctttcatggtgcaggcttggttgttccagtagataaaaatgatgttgggtaccgagagctccctgaaacagatgctgacctcaagagaatttgcaagacaatagttgaggctgcaagtgatgaggagagactaaaagcttttgctcccattcaggaaatgatgacttttgtgcagtttgctaatgatgaatgtgattatggcatggggcttgaattgggaatggatctcttttgctatggctcacattattttcataaagttgctggccagcttttacctcttgcatataatctgttgaagaggaatctgtttgcagaaattattgaggagcatctggcaaacagaagtcaagagaacatagaccaacttgctgcatga
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,436 Da
NCBI Official Full Name
Homo sapiens chromosome 4 open reading frame 27, mRNA
NCBI Official Synonym Full Names
histone PARylation factor 1
NCBI Official Symbol
HPF1
NCBI Official Synonym Symbols
C4orf27
NCBI Protein Information
UPF0609 protein C4orf27
UniProt Protein Name
UPF0609 protein C4orf27
UniProt Gene Name
C4orf27
UniProt Entry Name
CD027_HUMAN
Uniprot Description
HPF1: Belongs to the UPF0609 family.
Chromosomal Location of Human Ortholog: 4q33
Cellular Component: nucleus
Molecular Function: histone binding; protein binding
Biological Process: response to DNA damage stimulus
Research Articles on C4orf27
Similar Products
Product Notes
The C4orf27 c4orf27 (Catalog #AAA1272767) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcggcg gtggcgggaa gcgcaggccc ggcggggagg ggccgcagtg tgaaaaaaca actgatgtga agaaaagtaa attctgtgaa gctgatgtct ccagtgacct tcgaaaagaa gtagaaaatc attataagct ttctttacct gaagatttct atcacttctg gaagttctgt gaagaacttg atcctgaaaa gccatctgat tcactttctg caagccttgg acttcaatta gttggtcctt atgatatcct tgctggaaaa cataaaacga agaaaaaatc aacaggcctg aattttaacc ttcactggag gttttactat gatcctcctg agttccagac cattattatt ggagataata aaactcagta ccacatgggg tatttcaggg attctcctga tgaatttcct gtatatgttg gtataaatga agcaaagaaa aattgtataa ttgttccaaa tggagataat gtatttgctg cagtcaaatt atttttgacg aaaaaactta aagaaataac ggataaaaag aaaatcaatc tcttgaaaaa catagatgaa aaactcacag aagcagccag agaattgggg tactcgcttg aacagagaac cgtgaagatg aaacagagag ataagaaagt tgtgacaaag acctttcatg gtgcaggctt ggttgttcca gtagataaaa atgatgttgg gtaccgagag ctccctgaaa cagatgctga cctcaagaga atttgcaaga caatagttga ggctgcaagt gatgaggaga gactaaaagc ttttgctccc attcaggaaa tgatgacttt tgtgcagttt gctaatgatg aatgtgatta tggcatgggg cttgaattgg gaatggatct cttttgctat ggctcacatt attttcataa agttgctggc cagcttttac ctcttgcata taatctgttg aagaggaatc tgtttgcaga aattattgag gagcatctgg caaacagaag tcaagagaac atagaccaac ttgctgcatg a. It is sometimes possible for the material contained within the vial of "C4orf27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
