C3orf24 cdna clone
C3orf24 cDNA Clone
Gene Names
FANCD2OS; C3orf24
Synonyms
C3orf24; C3orf24 cDNA Clone; C3orf24 cdna clone
Sequence
atggcaggataccagctctggtcaccatggaccccactggatgagagtttccaatggctgcggcacacgacacctacaccttcctccaagcacccattcaaggcctccccctgcttcccacacacaccgtccgaccttgaagtgcagctgtgctttcaagaggtcactctagtcctagacagcccattcctggaatctggagtgagtcccaagttaccctgccacacatcagagttgcgcacgatgaacaacaaaggactggtcaggaagccccagcccatccgcctcagtggagtagattctgtctttggcagggttatcacagctcagccaccaaagtggaccgggactttcagagtttcagacaagtcagccttttgcaaaatcattagcagggagcaccagtggcccattggactgaaggagcctcagattcagatgacagtcactatgtgcaaacagatgctgcgctctatcctcttgctgtatgcaacttacaaaaagtgcacctttgccttgcagcactccaagtaa
Sequence Length
534
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,188 Da
NCBI Official Full Name
Homo sapiens chromosome 3 open reading frame 24, mRNA
NCBI Official Synonym Full Names
FANCD2 opposite strand
NCBI Official Symbol
FANCD2OS
NCBI Official Synonym Symbols
C3orf24
NCBI Protein Information
FANCD2 opposite strand protein
UniProt Protein Name
FANCD2 opposite strand protein
UniProt Gene Name
FANCD2OS
UniProt Synonym Gene Names
C3orf24
UniProt Entry Name
FACOS_HUMAN
NCBI Description
This gene encodes a conserved protein of unknown function. [provided by RefSeq, Jan 2013]
Uniprot Description
FANCD2OS:
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 3p25.3
Similar Products
Product Notes
The C3orf24 fancd2os (Catalog #AAA1278309) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggat accagctctg gtcaccatgg accccactgg atgagagttt ccaatggctg cggcacacga cacctacacc ttcctccaag cacccattca aggcctcccc ctgcttccca cacacaccgt ccgaccttga agtgcagctg tgctttcaag aggtcactct agtcctagac agcccattcc tggaatctgg agtgagtccc aagttaccct gccacacatc agagttgcgc acgatgaaca acaaaggact ggtcaggaag ccccagccca tccgcctcag tggagtagat tctgtctttg gcagggttat cacagctcag ccaccaaagt ggaccgggac tttcagagtt tcagacaagt cagccttttg caaaatcatt agcagggagc accagtggcc cattggactg aaggagcctc agattcagat gacagtcact atgtgcaaac agatgctgcg ctctatcctc ttgctgtatg caacttacaa aaagtgcacc tttgccttgc agcactccaa gtaa. It is sometimes possible for the material contained within the vial of "C3orf24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
