C1R cdna clone
C1R cDNA Clone
Synonyms
C1R; C1R cDNA Clone; C1R cdna clone
Sequence
atgtggctcttgtacctcctggtgccggccctgttctgcagggcaggaggctccattcccatccctcagaagttatttggggaggtgacttcccctctgttccccaagccttaccccaacaactttgaaacaaccactgtgatcacagtccccacgggatacagggtgaagctcgtcttccagcagtttgacctggagccttctgaaggctgcttctatgattatgtcaagatctctgctgataagaaaagcctggggaggttctgtgggcaactgggttctccactgggcaaccccccgggaaagaaggaatttatgtcccaagggaacaagatgctgctgaccttccacacagacttctccaacgaggagaatgggaccatcatgttctacaagggcttcctggcctactaccaagctgtggaccttgatgaatgtgcttcccggagcaaattaggggaggaggatccccagccccagtgccagcacctgtgtcacaactacgttggaggctacttctgttcctgccgtccaggctatgagcttcaggaagacaggcattcctgccaggctgagtgcagcagcgagctgtacacggaggcatcaggctacatctccagcctggagtaccctcggtcctacccccctgacctgcgctgcaactacagcatccgggtggagcggggcctcaccctgcacctcaagttcctggagccttttgatattgatgaccaccagcaagtacactgcccctatgaccagctacagatctatgccaacgggaagaacattggcgagttctgtgggaagcaaaggccccccgacctcgacaccagcagcaatgctgtggatctgctgttcttcacagatgagtcgggggacagccggggctggaagctgcgctacaccaccgagatcatcaagtgcccccagcccaagaccctagacgagttcaccatcatccagaacctgcagcctcagtaccagttccgtgactacttcattgctacctgcaagcaaggctaccagctcatagaggggaaccaggtgctgcattccttcacagctgtctgccaggatgatggcacgtggcatcgtgccatgcccagatgcaagatcaaggactgtgggcagccccgaaacctgcctaatggtgacttccgttacaccaccacaatgggagtgaacacctacaaggcccgtatccagtactactgccatgagccatattacaagatgcagaccagagctggcagcagggagtctgagcaaggggtgtacacctgcacagcacagggcatttggaagaatgaacagaagggagagaagattcctcggtgcttgccagtgtgtgggaagcccgtgaaccccgtggaacagaggcagcgcatcatcggagggcaaaaagccaagatgggcaacttcccctggcaggtgttcaccaacatccacgggcgcgggggcggggccctgctgggcgaccgctggatcctcacagctgcccacaccctgtatcccaaggaacacgaagcgcaaagcaacgcctctttggatgtgttcctgggccacacaaatgtggaagagctcatgaagctaggaaatcaccccatccgcagggtcagcgtccacccggactaccgtcaggatgagtcctacaattttgagggggacatcgccctgctggagctggaaaatagtgtcaccctgggtcccaacctcctccccatctgcctccctgacaacgataccttctacgacctgggcttgatgggctatgtcagtggcttcggggtcatggaggagaagattgctcatgacctcaggtttgtccgtctgcccgtagctaatccacaggcctgtgagaactggctccggggaaagaataggatggatgtgttctctcaaaacatgttctgtgctggacacccatctctaaagcaggacgcctgccagggggatagtgggggcgtttttgcagtaagggacccgaacactgatcgctgggtggccacgggcatcgtgtcctggggcatcgggtgcagcaggggctatggcttctacaccaaagtgctcaactacgtggactggatcaagaaagagatggaggaggaggactga
Sequence Length
2118
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
80,119 Da
NCBI Official Full Name
Homo sapiens complement component 1, r subcomponent, mRNA
NCBI Official Synonym Full Names
complement C1r
NCBI Official Symbol
C1R
NCBI Protein Information
complement C1r subcomponent
UniProt Protein Name
Complement C1r subcomponent
Protein Family
UniProt Gene Name
C1R
UniProt Entry Name
C1R_HUMAN
Uniprot Description
C1R: C1r B chain is a serine protease that combines with C1q and C1s to form C1, the first component of the classical pathway of the complement system. Belongs to the peptidase S1 family.
Protein type: EC 3.4.21.41; Protease
Chromosomal Location of Human Ortholog: 12p13
Cellular Component: extracellular region
Molecular Function: protein binding; serine-type endopeptidase activity; serine-type peptidase activity
Biological Process: complement activation; complement activation, classical pathway; immune response
Disease: Complement Component C1r/c1s Deficiency; Ehlers-danlos Syndrome, Periodontal Type, 1
Research Articles on C1R
Similar Products
Product Notes
The C1R c1r (Catalog #AAA1272754) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggctct tgtacctcct ggtgccggcc ctgttctgca gggcaggagg ctccattccc atccctcaga agttatttgg ggaggtgact tcccctctgt tccccaagcc ttaccccaac aactttgaaa caaccactgt gatcacagtc cccacgggat acagggtgaa gctcgtcttc cagcagtttg acctggagcc ttctgaaggc tgcttctatg attatgtcaa gatctctgct gataagaaaa gcctggggag gttctgtggg caactgggtt ctccactggg caaccccccg ggaaagaagg aatttatgtc ccaagggaac aagatgctgc tgaccttcca cacagacttc tccaacgagg agaatgggac catcatgttc tacaagggct tcctggccta ctaccaagct gtggaccttg atgaatgtgc ttcccggagc aaattagggg aggaggatcc ccagccccag tgccagcacc tgtgtcacaa ctacgttgga ggctacttct gttcctgccg tccaggctat gagcttcagg aagacaggca ttcctgccag gctgagtgca gcagcgagct gtacacggag gcatcaggct acatctccag cctggagtac cctcggtcct acccccctga cctgcgctgc aactacagca tccgggtgga gcggggcctc accctgcacc tcaagttcct ggagcctttt gatattgatg accaccagca agtacactgc ccctatgacc agctacagat ctatgccaac gggaagaaca ttggcgagtt ctgtgggaag caaaggcccc ccgacctcga caccagcagc aatgctgtgg atctgctgtt cttcacagat gagtcggggg acagccgggg ctggaagctg cgctacacca ccgagatcat caagtgcccc cagcccaaga ccctagacga gttcaccatc atccagaacc tgcagcctca gtaccagttc cgtgactact tcattgctac ctgcaagcaa ggctaccagc tcatagaggg gaaccaggtg ctgcattcct tcacagctgt ctgccaggat gatggcacgt ggcatcgtgc catgcccaga tgcaagatca aggactgtgg gcagccccga aacctgccta atggtgactt ccgttacacc accacaatgg gagtgaacac ctacaaggcc cgtatccagt actactgcca tgagccatat tacaagatgc agaccagagc tggcagcagg gagtctgagc aaggggtgta cacctgcaca gcacagggca tttggaagaa tgaacagaag ggagagaaga ttcctcggtg cttgccagtg tgtgggaagc ccgtgaaccc cgtggaacag aggcagcgca tcatcggagg gcaaaaagcc aagatgggca acttcccctg gcaggtgttc accaacatcc acgggcgcgg gggcggggcc ctgctgggcg accgctggat cctcacagct gcccacaccc tgtatcccaa ggaacacgaa gcgcaaagca acgcctcttt ggatgtgttc ctgggccaca caaatgtgga agagctcatg aagctaggaa atcaccccat ccgcagggtc agcgtccacc cggactaccg tcaggatgag tcctacaatt ttgaggggga catcgccctg ctggagctgg aaaatagtgt caccctgggt cccaacctcc tccccatctg cctccctgac aacgatacct tctacgacct gggcttgatg ggctatgtca gtggcttcgg ggtcatggag gagaagattg ctcatgacct caggtttgtc cgtctgcccg tagctaatcc acaggcctgt gagaactggc tccggggaaa gaataggatg gatgtgttct ctcaaaacat gttctgtgct ggacacccat ctctaaagca ggacgcctgc cagggggata gtgggggcgt ttttgcagta agggacccga acactgatcg ctgggtggcc acgggcatcg tgtcctgggg catcgggtgc agcaggggct atggcttcta caccaaagtg ctcaactacg tggactggat caagaaagag atggaggagg aggactga. It is sometimes possible for the material contained within the vial of "C1R, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
