Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C1orf31 cdna clone

C1orf31 cDNA Clone

Gene Names
COA6; C1orf31; CEMCOX4
Synonyms
C1orf31; C1orf31 cDNA Clone; C1orf31 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGCCCGGGAGGTCCCTTACTGTCCCCGAGCCGCGGGTTCCTCTTGTGCAAAACGGGGTGGCACTCCAATCGCCTGCTTGGTGATTGTGGCCCCCACACACCTGTTTCTACAGCGCTTAGCTTCATCGCAGTAGGAATGGCAGCCCCATCTATGAAGGAAAGACAGGTCTGCTGGGGGGCCCGGGATGAGTACTGGAAGTGTTTAGATGAGAACTTAGAGGATGCTTCTCAATGCAAGAAGTTAAGAAGCTCTTTCGAATCAAGTTGTCCCCAACAGTGGATAAAATATTTTGATAAAAGAAGAGACTACTTAAAATTCAAAGAAAAATTTGAAGCAGGACAATTTGAGCCTTCAGAAACAACTGCAAAATCCTAG
Sequence Length
378
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,428 Da
NCBI Official Full Name
Homo sapiens chromosome 1 open reading frame 31, mRNA
NCBI Official Synonym Full Names
cytochrome c oxidase assembly factor 6
NCBI Official Symbol
COA6
NCBI Official Synonym Symbols
C1orf31; CEMCOX4
NCBI Protein Information
cytochrome c oxidase assembly factor 6 homolog
UniProt Protein Name
Cytochrome c oxidase assembly factor 6 homolog
UniProt Gene Name
COA6
UniProt Synonym Gene Names
C1orf31
UniProt Entry Name
COA6_HUMAN

NCBI Description

This gene encodes a member of the cytochrome c oxidase subunit 6B family. The encoded protein associates with cytochrome c oxidase may act has an cytochrome c oxidase mitochondrial respiratory complex VI assembly factor. Mutations in this gene may be associated with fatal infantile cardiomyopathy. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Uniprot Description

COA6: Belongs to the cytochrome c oxidase subunit 6B family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1q42.2

Cellular Component: mitochondrial intermembrane space; mitochondrion

Molecular Function: copper ion binding; protein binding

Biological Process: plasma membrane ATP synthesis coupled electron transport; respiratory chain complex IV assembly

Disease: Cardioencephalomyopathy, Fatal Infantile, Due To Cytochrome C Oxidase Deficiency 4

Research Articles on C1orf31

Similar Products

Product Notes

The C1orf31 coa6 (Catalog #AAA1270326) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGCCCGG GAGGTCCCTT ACTGTCCCCG AGCCGCGGGT TCCTCTTGTG CAAAACGGGG TGGCACTCCA ATCGCCTGCT TGGTGATTGT GGCCCCCACA CACCTGTTTC TACAGCGCTT AGCTTCATCG CAGTAGGAAT GGCAGCCCCA TCTATGAAGG AAAGACAGGT CTGCTGGGGG GCCCGGGATG AGTACTGGAA GTGTTTAGAT GAGAACTTAG AGGATGCTTC TCAATGCAAG AAGTTAAGAA GCTCTTTCGA ATCAAGTTGT CCCCAACAGT GGATAAAATA TTTTGATAAA AGAAGAGACT ACTTAAAATT CAAAGAAAAA TTTGAAGCAG GACAATTTGA GCCTTCAGAA ACAACTGCAA AATCCTAG. It is sometimes possible for the material contained within the vial of "C1orf31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.